Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Pichia stipitis gene expression system and its construction and application

A Pichia stipitis and expression system technology, applied in the direction of microorganism-based methods, using vectors to introduce foreign genetic material, microorganisms, etc., can solve problems such as the inability to meet the construction and application of high-efficiency expression vectors

Active Publication Date: 2017-11-21
JIANGNAN UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Currently, there are few available vector elements, such as promoters, screening markers, etc., which cannot satisfy the construction and application of high-efficiency expression vectors

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Pichia stipitis gene expression system and its construction and application
  • Pichia stipitis gene expression system and its construction and application
  • Pichia stipitis gene expression system and its construction and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0111] Example 1: Construction of PR series integrated expression vectors

[0112] 1. Construction of recombinant plasmid pMD-18s rDNA

[0113] (1) According to the whole genome sequence of Spathaspora passalidarum (GenBank accession NZ_AEIK00000000), two primers were designed to intercept the partial sequence of Spathaspora passalidarum 18s rDNA as the homologous recombination site. The primer sequences are as follows: the underlined part of primer P1 is the recognition site of EcoR I, and the underlined part of primer P2 is the recognition site of Bgl II, BamH I and Kpn I respectively from the 5' to 3' ends.

[0114] P1: 5'GCCG GAATTC TGCCAGTAGTCATATGCTTGTCTC3'

[0115] P2: 5'ATATTAGG GGTACC CG GGATCC GA AGATCT GTTGAAGAGCAATAAT3'

[0116] (2) Cultivate Spathaspora passalidarum overnight, collect cells, separate and extract genomic DNA.

[0117] (3) Spathaspora passalidarum genomic DNA was used as a template, and PCR amplification was performed with primers P1 and ...

Embodiment 2

[0176] Example 2: Construction of PA series of integrated expression vectors

[0177] 1. Construction of recombinant plasmid pMD-PsARS2

[0178] (1) According to the DNA sequence of the self-replicating sequence of Pichia stipitis (GenBank accession U08628.1), two primers, P19 and P20, were designed. The primer sequences are as follows: the underlined part of primer P33 is the recognition site of EcoR I, and the underlined part of primer P34 is the recognition site of Bgl II, BamH I and Kpn I respectively from the 5' to 3' ends.

[0179] P33: 5'GCGCCG GAATTC AGTATAGGATATGGTGTTTAG 3’

[0180] P34: 5'ATTGG GGTACC CG GGATCC GA AGATCT TCTGCGGTGTC3'

[0181] (2) Cultivate Pichia stipitis overnight, collect cells, separate and extract genomic DNA.

[0182] (3) PCR amplification was performed with primers P33 and P34 using the genome DNA of the Pichia stipitis host strain as a template. The amplification conditions were pre-denaturation at 95°C for 5 min, denaturation at ...

Embodiment 3

[0217] Example 3: Establishment of PEG / LiAc-mediated transformation method of Pichia stipitis.

[0218] Using Scheffersomyces stipitis NRRL Y-7124 as the host bacterium, the method of transforming yeast mediated by PEG / LiAc is implemented as follows:

[0219] 1. Preparation of Scheffersomyces stipitis NRRL Y-7124 Competent State

[0220] (1) Inoculate the Scheffersomyces stipitis NRRL Y-7124 stored in the cryopreservation tube into the YPD medium, and activate the shake flask for 48 hours.

[0221] (2) Streak the activated bacterial solution on the YPD plate and store it at 4°C.

[0222] (3) Pick a single colony of Scheffersomyces stipitis NRRL Y-7124 from a YPD plate, inoculate it in 20 ml of YPD medium, and culture it overnight at 30° C. in a 100 ml shaker flask.

[0223] (4) Inoculate 50ml of YPD culture medium with the fresh bacterial solution cultivated overnight, and culture it in a 250ml shake flask at 30°C and 200rpm until the OD600 of the bacterial solution reaches ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to a Pichia stipitis gene expression system and its construction and application, including a novel expression vector, which is circular and operably connected with the following elements sequentially from 5'-3': pMD19-Tsimple plasmid backbone, rDNA homologous recombination sequence, exogenous gene expression cassette and screening marker gene expression cassette; the exogenous gene expression cassette includes promoter, exogenous gene insertion restriction site and transcription terminator in sequence from upstream to downstream; the screening The marker gene expression cassette includes a promoter, an antibiotic resistance gene, and a transcription terminator. The yeast capable of utilizing xylose is Pichia stipitis. The expression vector of the present invention can realize integrated stable expression in Pichia stipitis, and has important significance for basic theoretical research and product development of Pichia stipitis.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to an expression system of Pichia stipitis (Scheffersomycesstipitis) and its construction method and application. Background technique [0002] With the continuous deepening of theoretical research on molecular biology and the continuous innovation of molecular biological methods, genetic engineering technology has developed rapidly and achieved remarkable results. As an important content of genetic engineering technology, gene expression technology has penetrated into various fields of industry, agriculture and life science, and has been widely valued by people. According to the different hosts for exogenous gene expression, at present, the gene expression systems that have been developed include Escherichia coli expression system, mammalian expression system, yeast expression system and so on. Among them, the yeast expression system has the advantages of simple operat...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/81C12R1/84
Inventor 张梁范贺超高芝李由然石贵阳顾正华李赢丁重阳何冬旭
Owner JIANGNAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com