Specific grape powdery mildew resistant gene VpR8H-1 cDNA (complementary deoxyribonucleic acid) sequence and application of cDNA sequence

A powdery mildew resistance gene and grape technology, applied in the field of genetic engineering, can solve problems such as unreported research

Inactive Publication Date: 2015-02-18
NORTHWEST A & F UNIV
View PDF1 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The Arabidopsis broad-spectrum disease resistance gene RPW8.2 is a very special type of disease resistance gene in plants. Its homologous gene is only found in a few plants such as rape and grape, and it is only studied in the model plant Arabidopsis , while studies in grape and rapeseed have not been reported

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Specific grape powdery mildew resistant gene VpR8H-1 cDNA (complementary deoxyribonucleic acid) sequence and application of cDNA sequence
  • Specific grape powdery mildew resistant gene VpR8H-1 cDNA (complementary deoxyribonucleic acid) sequence and application of cDNA sequence
  • Specific grape powdery mildew resistant gene VpR8H-1 cDNA (complementary deoxyribonucleic acid) sequence and application of cDNA sequence

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] Example 1: Grape VpR8H-1 Gene Cloning and Sequence Analysis

[0023] a. Total RNA extraction and purification

[0024] Add 800 μl of SDS extraction buffer to a 2ml centrifuge tube, add a final concentration of 3% β-mercaptoethanol, mix thoroughly, take 100 mg of Baihe-35-1 grape leaves, put them in a liquid nitrogen precooled mortar, Grind thoroughly in nitrogen without lumps and quickly transfer to a centrifuge tube with extraction buffer, vortex to mix, ice bath for 20min, extract with chloroform:isoamyl alcohol at 24:1, add 1 / 3 volume of 8M LiCl to precipitate For RNA, wash the pellet twice with 75% ethanol, dry at room temperature for 10 min, add 30 μl DEPC-H 2 Dissolve in O, measure the OD value after electrophoresis detection, purify, take 2 μl RNA for 1.0% agarose gel electrophoresis to test the purity, take 1 μl to check the RNA concentration and freeze it at -80°C for later use;

[0025] b. cDNA synthesis

[0026] Using the extracted and purified total RNA a...

Embodiment 2

[0031] Example 2: Response of Tobacco Transient Expression VpR8H-1 Gene to Powdery Mildew

[0032] a. VpR8H-1 gene cloning

[0033] Extract the leaf RNA of the Chinese wild grape Baihe-35-1 strain, reverse-transcribe it into cDNA, and use the cDNA as a template to amplify the target gene by PCR. The upstream and downstream primers respectively introduce BamH Ⅰ restriction site, and the upstream primer : 5'AAGGATCCATGCGAATACAGGTTCATTATGTC3', downstream primer: 5'GGGGATCCACGCGGACTTCAAGATGATAGTTTC3', PCR reaction system: 1 μl of DNA template, high-fidelity LA enzyme, 1 μl of upstream and downstream primers, the reaction program is: 94°C for 2min, 94°C for 30S, 50°C for 30S, 3 min at 72°C, 30 cycles, 10 min at 72°C, 10 min at 4°C, and electrophoresis of the PCR product on a 1% agarose gel;

[0034] b. Plant expression vector construction

[0035] b.1 Recovery of target gene DNA fragments,

[0036] The DNA fragment of the target gene was recovered from the agarose gel with the D...

Embodiment 3

[0052] Example 3: The response of Arabidopsis stably expressing the VpR8H-1 gene to powdery mildew

[0053] a. VpR8H-1 gene cloning

[0054] The leaf RNA of the Chinese wild grape Baihe-35-1 strain was extracted, reverse-transcribed into cDNA, and the cDNA was used as a template to amplify the target gene by PCR, and a BamH Ⅰ restriction site was introduced into the upstream and downstream primers; the reaction procedure For: 94°C for 2 minutes, 94°C for 30S, 50°C for 30S, 72°C for 3min, 30 cycles, 72°C for 10min, 4°C for 10min, the PCR product was subjected to 1% agarose gel electrophoresis;

[0055] b. Plant expression vector construction

[0056] b.1 Recovery of target gene DNA fragments

[0057] The DNA fragment of the target gene was recovered from the agarose gel with the DNA recovery kit of Tiangen Biochemical Technology Co., Ltd., and the operation was carried out according to the kit instructions;

[0058] b.2 Ligation reaction between recovered fragment and clonin...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a specific grape powdery mildew resistant gene VpR8H-1 cDNA (complementary deoxyribonucleic acid) sequence and an application of the cDNA sequence. A VpR8H-1 gene is cloned from cDNA of leaves of Chinese wild vitis pseudoreticulata Baihe-35-1, the overall length of gDNA is 3136bp, the overall length of cDNA is 2448 bp, the gene comprises five exons and four introns, 815 amino acid is inferred and coded, an open reading frame sequence of VpR8H-1 is cloned to a plant expression vector, instantaneous conversion of tobaccos is performed, stable conversion of arabidopsis thaliana is performed, powdery mildew is inoculated, and specific positioning expression and disease resistant functions of the gene are verified. Functional analysis proves that the gene has specific positioning expression and disease resistant functions, can be directly applied to improve disease resistance of crops, and can further be indirectly used as a vector to improve the disease resistance of crops; and further, the VpR8H-1 gene has remarkable response to different hormones and biotic and abiotic stress, thereby having positive effects in the aspects of response to hormone treatment, biotic and abiotic stress and the like.

Description

technical field [0001] The invention relates to a plant disease-resistant gene sequence and its application, in particular to a grape specific powdery mildew resistance gene VpR8H-1cDNA sequence and its application, and belongs to the field of genetic engineering. Background technique [0002] During the growth and development of plants, they will continue to be attacked by various pathogens such as powdery mildew, downy mildew and rust, which will cause huge economic losses in production. Through long natural selection, plants have gradually evolved a variety of different disease resistance genes to resist the invasion of pathogenic bacteria. At present, many disease resistance genes have been cloned in plants, but only a few genes can resist powdery mildew, such as barley genes mlo, Mla1, Mla6 and Mla7 / 10 / 13, Arabidopsis genes RPW8.1, RPW8.2 and Wheat gene Lr34. Since most of the disease-resistant genes only have certain resistance to one or several pathogenic bacteria, ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/29C12N15/10C12N15/82
Inventor 文颖强韩永涛马辉高玉荣
Owner NORTHWEST A & F UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap