Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Screening method and application of plasma microRNA markers for identifying gastric cancer

A biomarker, cel-mir-39 technology, applied in the direction of DNA / RNA fragments, recombinant DNA technology, microbial determination / inspection, etc., can solve the problems affecting the reliability of screening results, etc., to achieve high sensitivity and strong specificity , the effect of improving reliability

Active Publication Date: 2014-07-23
SHANGHAI JIAO TONG UNIV
View PDF7 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, most of the existing large-sample cancer differential miRNA screening studies still use a single type of reference miRNA for relative quantification, which greatly affects the reliability of the screening results.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Screening method and application of plasma microRNA markers for identifying gastric cancer
  • Screening method and application of plasma microRNA markers for identifying gastric cancer
  • Screening method and application of plasma microRNA markers for identifying gastric cancer

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Example 1, Determination of the Concentration of Inserted Exogenous cel-miR-39 in Plasma

[0036] (1) Plasma RNA extraction

[0037] Take the same plasma sample and add 200 μL of plasma to RNase-free 1.5 mL centrifuge tubes. Subsequently, according to the operating instructions, use mirVana Paris Kit (SKU: AM1556, Ambion) for RNA extraction. The steps are slightly modified as follows: After adding 2× denaturing solution to the plasma, then add 2.5 μL successively with concentrations of 0.005, 0.05, and 0.5 , 5 μM cel-miR-39 solution, followed by adding phenol-chloroform mixture for centrifugation, adding phenol-chloroform mixture to the obtained upper aqueous phase again for mixing and centrifugation, and finally, washing with 100 μL 95°C preheated DEPC-treated water take off.

[0038] (2) qRT-PCR determination of cel-miR-39

[0039] reverse transcription:

[0040]Reverse transcription was performed with TaqMan MicroRNA Reverse Transcription Kit (SKU: 4366596, App...

Embodiment 2

[0045] Embodiment 2, cell microRNA detection

[0046] (1) Extraction of cellular RNA

[0047] First, gastric cancer cell line MGC803101 overexpressing miR-101 was constructed and cultured, gastric cancer cell line MGC803 and normal gastric mucosal epithelial cell line GES-1 were cultured simultaneously. Among them, the gastric cancer cell line overexpressing miR-101 was constructed by our laboratory, and the process was as follows: First, construct the hsa-miR-101 lentiviral expression vector. A 490bp fragment expressing miR-101 was amplified from DNA extracted from HEK293T cells, cloned into the pCDH1-CMV-MCS-EF1a-GFP-T2A-Puro expression vector, and a negative control Negative control was set at the same time; the primers adopted were as follows:

[0048] PCR primers:

[0049] miR-101-1F: CCTGAATTCATTCTAATTTAATTCAACTGG (SEQ ID NO: 7)

[0050] miR-101-1R: TATGGATCCTCAGCACAACATGGCTGCAC (SEQ ID NO: 8)

[0051] (Restriction site: EcoRI / BamHI)

[0052] Second, packaging len...

Embodiment 3

[0063] Example 3, large sample size plasma microRNA detection

[0064] (1) Plasma RNA extraction

[0065] Take a plasma sample and add 200 μL of plasma to an RNase-free 1.5 mL centrifuge tube. Subsequently, according to the operating instructions, use mirVana Paris Kit (SKU: AM1556, Ambion) for RNA extraction, the steps are slightly modified as follows: add 2× denaturing solution to the plasma, and then add 2.5 μL of 0.5 μM cel-miR- 39 solution, then add phenol-chloroform mixture for centrifugation, add phenol-chloroform mixture again to the obtained upper aqueous phase for mixing and centrifugation, and finally, use 100 μL 95°C preheated DEPC-treated water for elution.

[0066] (2) qRT-PCR detection of miR-21

[0067] The miR-21 sequence is shown in SEQ ID NO:6. For the reverse transcription steps, refer to the qRT-PCR measurement of cel-miR-39 described in Example 1.

[0068] qPCR:

[0069] Take 10 μL of cDNA solution obtained above, pipette 3 μL, and keep it for late...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Login to View More

Abstract

The invention discloses a screening method and application of a plasma microRNA marker for identifying a gastric cancer. According to the screening method, cel-miR-39 serving as an external reference and miR-16 serving as an internal reference are used together, and data of to-be-tested microRNA are normalized, so as to improve the reliability of qRT-PCR data. On the basis of the method, plasma microRNA markers, namely miR-19b, miR-671-5p and miR-101, are screened, wherein the miR-19b and the miR-671-5p are used for distinguishing normal people from the patients with gastric cancer at different stages and different differentiated degrees, and can be used as the markers for gastric cancer screening; and especially the miR-671-5p is used for specifically distinguishing the patient with early gastric cancer from normal people. Therefore, the plasma microRNA markers can be used as characteristic markers for early gastric cancer diagnosis. The miR-101 is used for distinguishing the patients with gastric cancer before and after an operation, and can be used as a prognosis marker of the gastric cancer.

Description

technical field [0001] The invention relates to the fields of medicine and molecular diagnosis, in particular to the screening and application of a plasma microRNA marker for distinguishing gastric cancer. Background technique [0002] Gastric cancer is one of the most common malignant tumors of the digestive tract in China, ranking first in the mortality rate of malignant tumors in my country. At present, the diagnosis of gastric cancer is still based on imaging, endoscopy, and histopathology as the main diagnostic methods. However, when gastric cancer is diagnosed clinically, it is usually at an advanced stage, and the effects of conventional surgery, chemotherapy, and radiotherapy are poor, and the prognosis is poor. However, the diagnostic method with the help of tumor markers can solve the above problems to a certain extent. At present, the tumor markers that are considered to have clinical value in the diagnosis of gastric cancer mainly include carcinoembryonic antig...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/113
CPCC12Q1/6886C12Q2600/112C12Q2600/118C12Q2600/158C12Q2600/178
Inventor 崔大祥张晶璞
Owner SHANGHAI JIAO TONG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com