Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Expression method and purification of mouse epidermal growth factor in pichia pastoris

A technique for epidermal growth factor and expression method, which is applied in the field of expression method and purification of mouse epidermal growth factor in Pichia pastoris GS115, and achieves the effect of simple purification and large-scale processing.

Inactive Publication Date: 2014-06-25
杭州璞题生物科技有限公司
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] In view of the deficiencies in the prior art, the purpose of the present invention is to solve the problem of secreting and expressing recombinant mouse epidermal growth factor in Pichia pastoris GS115, and provide a high-efficiency and stable construction and screening of engineering bacteria expressing mEGF , and the method for separating and purifying the target protein mEGF

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Expression method and purification of mouse epidermal growth factor in pichia pastoris
  • Expression method and purification of mouse epidermal growth factor in pichia pastoris
  • Expression method and purification of mouse epidermal growth factor in pichia pastoris

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0013] Example 1 : Construction of recombinant plasmid pBSAZ 2.1

[0014] 1) Test material

[0015] (1) Plasmids and strains

[0016] Plasmids pPIC 9k, pMAL-p5X and Escherichia coli JM109 were purchased from Takara Biotechnology Co., Ltd.

[0017] (2) Reagents

[0018] restriction endonuclease Eco R I and not I, kanamycin and kanamycin were purchased from NEB Company.

[0019] The gene fragment mEGF and primers were synthesized by BGI.

[0020] m-F: CGGAATTCAATAGTTATCCAGGAT

[0021] m-R: TAATGCTCCTGCTGCGAACTCCTCTAGTAACTGGAAATAGGTTCTC

[0022] M-F: GAGAACCTATATTTCCAGTTACTAGAGGAGTTCGCAGCAGGAGCATTAAAAAATAAAAAACAGGT

[0023] M-R:

[0024] ATAAGAATGCGGCCGCCGCTGCTGTGATGATGATGATAGTCTGCGCGTC

[0025] 2) Implementation plan

[0026] 1. Digestion of plasmid pPIC9k

[0027] Extract a large amount of reconstituted plasmid pPIC 9k, add restriction endonuclease after purification Eco R I and not I. Place in a constant temperature incubator at 37°C for 2-3 hours for doubl...

Embodiment 2

[0038] Example 2: Electrotransformation of Pichia pastoris

[0039] 1. Linearization of recombinant plasmid pBSAZ 2.1

[0040] Recombinant plasmid pBSAZ 2.1 using restriction enzymes Bgl ПLinearization, after purification and recovery, perform 1% agarose gel electrophoresis to confirm the correctness of the purified and recovered fragments.

[0041] 2. Preparation of Competent Cells

[0042] A single colony of Pichia pastoris GS115 was picked and inoculated into a shake flask containing 50 mL of YEPD medium at 30°C and 150 rpm for overnight cultivation. Take 100 μL of the culture and transfer it to a shaker flask containing 50 mL of fresh YEPD medium at 30 ° C, 150 rpm, and measure the OD600 value. When it reaches 1.3-1.5, pour the cell culture into a pre-cooled sterile 50 mL centrifuge tube, Centrifuge at 4000rpm for 5min at 4°C. Under sterile conditions, resuspend the bacterial pellet with 50 mL of pre-cooled sterile water for each tube. Centrifuge at 4000rpm for 5...

Embodiment 3

[0045] Example 3 : Screening of positive recombinant strains

[0046] 1. Using Pichia pastoris GS115 histidine auxotrophy to screen integrated recombinant bacteria

[0047] Centrifuge the static cultured bacterial solution at 1500rpm for 5 minutes, spread it on an MD plate, and culture it in a constant temperature incubator at 30°C for 2-3 days until a single colony grows.

[0048] 2. G418 resistance screening for high copy strains

[0049] Use toothpicks to inoculate the colonies grown on the MD plate onto 1.5mg / ml-2mg / ml G418 YEPD plates, and culture them in a constant temperature incubator at 30°C for about three days. Select the longer and larger colonies to inoculate with 1.5mg / ml-2mg / ml G418 YEPD liquid medium, cultivate overnight on a shaker at 30°C, and store the strain at -80°C.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an expression method and purification of a mouse epidermal growth factor in pichia pastoris. The expression method comprises the following steps: (1) constructing recombinant plasmid pBSAZ2.1; (2) carrying out electrotransformation and expression of recombinant pichia pastoris of pBSAZ2.1 protein; (3) screening positive recombinant strains; (4) inducing recombinant bacteria to express the mouse epidermal growth factor; (5) purifying the mouse epidermal growth factor. According to the invention, a genetic engineering method is adopted, mEGF genes are connected to an expression vector, and secretory expression is completed in pichia pastoris cells so as to construct genetic engineering bacteria containing mEGF target genes. The expression method and purification can guide correct folding of protein, and provide various complex post-translational processing functions such as glycosylation, so that the an expression product is the most close to a natural biological protein molecule in terms of molecular structure, physical and chemical properties and biological functions. The expression method and purification can avoid the formation of an inclusion body caused by protein aggregation in the cells so as to enable the downstream purification of interest protein to be easier, and be beneficial to large-scale treatment.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to the expression method and purification of mouse epidermal growth factor in Pichia pastoris GS115. Background technique [0002] Mouse Epidermal Growth Factor (mEGF for short) is a single-chain polypeptide containing 53 amino acids with a molecular weight of 6054 Daltons. Mouse epidermal growth factor can bind to specific transmembrane receptors, causing a series of biochemical changes in cells, making static cells enter the division cycle, promoting cell proliferation, and reaching life balance after a period of time, and cells no longer proliferate indefinitely. Therefore, mouse epidermal growth factor is a powerful cell division promoter, and a small amount of exogenous mouse epidermal growth factor can stimulate cell proliferation, thereby accelerating the regeneration and repair of damaged skin and inner epithelium, and reducing skin deformity. Therefore, mouse epidermal g...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/81C07K14/485C07K1/22C12R1/84
Inventor 王喆明
Owner 杭州璞题生物科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com