Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Preparation method of human neutrophil gelatinase associated lipocalin (NGAL)

A neutrophil and apolipoprotein technology, which is applied in the field of preparation of recombinant human neutrophil gelatinase-related apolipoprotein, can solve the problems of low integration efficiency of circular plasmids, imperfect processing and modification systems, cumbersome purification, etc.

Inactive Publication Date: 2014-06-25
BEIJING AMBITION BIOTECH
View PDF1 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

But at the same time, there are still many insurmountable shortcomings in the prokaryotic expression system: for example, the target protein is often expressed in the form of inclusion bodies, which leads to difficulties in product purification; and the post-translational processing and modification system of the prokaryotic expression system is not perfect, and the biological activity of the expressed product is low.
[0024] 2) Linearization of the recombinant vector: the integration efficiency of the recombinant vector can be greatly improved only when the recombinant vector is linearized by enzyme digestion, and the integration efficiency of circular plasmids is very low
However, only the colony PCR method is used for colony screening. If recombinant strains with higher expression levels are screened, hundreds or even thousands of recombinant strains need to be screened out. In addition, even if G418 is used for screening, when the colony density is high , will produce many false positives; moreover, in protein purification, the purification is cumbersome and requires ammonium sulfate precipitation, desalting, cation exchange, etc.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method of human neutrophil gelatinase associated lipocalin (NGAL)
  • Preparation method of human neutrophil gelatinase associated lipocalin (NGAL)
  • Preparation method of human neutrophil gelatinase associated lipocalin (NGAL)

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0068] The preparation method of human neutrophil gelatinase-associated apolipoprotein (NGAL) in this embodiment comprises the following steps:

[0069] 1. Construction of pPICZαB-NGAL expression vector

[0070] (1) Whole gene synthesis of NGAL: chemically synthesize the nucleotide sequence of the NGAL gene according to the codon preference of Pichia pastoris, and the final gene is the base sequence shown in SEQ ID NO:1.

[0071] (2) Use the above-mentioned synthesized base sequence as a template, and use the three designed primers as upstream and downstream primers to perform nested PCR amplification. The primers required for the first PCR are as follows:

[0072] Upstream primer NGAL-U1 (5'His underlined):

[0073] GAAGCT CATCACCACCATCACCAT CAAGACTCCACCTCTGACTT

[0074] Downstream primer NGAL-R (notI site is underlined):

[0075] TTCTT GCGGCCGC TTATCAACCGTCGATACATTGGTCGA

[0076] The first PCR reaction system is:

[0077]

[0078] The amplification conditions are...

Embodiment 2

[0123] The method used in this example is basically the same as the method used in Example 1. The method described here mainly includes primer design, PCR and its product purification, restriction endonuclease digestion treatment, T4 ligase connection, transformation Cloning and identification of strains, induced expression, purification after expression, enzyme activity detection methods, etc.

[0124] The difference from Example 1 is that Pichia pastoris (Pichia pastoris) GS-115 was selected to express NGAL after the construction of the recombinant NGAL engineering bacteria was completed.

[0125] The previous results of PCR, clone identification, protein expression and protein purification are basically the same as in Example 1, and will not be repeated here.

[0126] The constructed recombinant expression vector NGAL-pPICZαB of human neutrophil gelatinase-associated apolipoprotein yeast system was introduced into GS-115 Pichia pastoris competent cells, and experiments such...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method of preparing human neutrophil gelatinase associated lipocalin (NGAL) in pichia pastoris. The method comprises the following steps: providing a nucleotide sequence which codes the NGAL; cloning the nucleotide sequence of the NGAL to different yeast expression vectors; converting the yeast expression vectors to one yeast host; inducing the yeast host to express the NGAL with a histidine label at the terminal C; and purifying the treated NGAL in the step 4). The method is high in expression quantity, and the expression product does not need to be subjected to denaturation and renaturation, and the human NGAL with activity can be obtained. The subsequent purifying steps are further simple and convenient. The prepared human NGAL can be used for a NGAL detection kit for detecting acute kidney injury.

Description

technical field [0001] The invention relates to a method for preparing gene recombinant human neutrophil gelatinase-associated apolipoprotein (NGAL), in particular to a method for preparing recombinant human neutrophil gelatinase-associated apolipoprotein (NGAL) in yeast )Methods. Background technique [0002] 1. Human neutrophil gelatinase-associated apolipoprotein (NGAL) [0003] Human neutrophil gelatinase-associated apolipoprotein NGAL (neutrophil gelatinase-associated lipocalin) is a new member of the lipocalin (apolipoprotein) family. Kjeldsen et al. studied neutrophil gelatinase and matrix metalloproteinase in 1993 9 (Matrix Metalloproteinase-9, MMP-9; gelatinase B) was found. Subsequently, NGAL cDNA and its full gene sequence were cloned and identified in 1994 and 1997, respectively. NGAL protein is composed of a polypeptide chain, and its molecular weight is 25kD glycoprotein, containing 178 amino acid residues. The polypeptide chain consists of a 310-helix at t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/775C12N15/81C12N15/12
CPCC07K14/775C12N15/815
Inventor 彭毅翟文庞朋沙
Owner BEIJING AMBITION BIOTECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com