Brown planthopper gene Nl1860 as well as encoding product and application thereof
A technology for brown planthoppers and transgenic plants, which is applied in the fields of application, genetic engineering, plant gene improvement, etc. It can solve the problems of reducing related genes, not cloning brown planthoppers, and the lethal effect of brown planthoppers is not obvious, so as to achieve good insect resistance effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0032] Embodiment 1, Nl1860 Gene acquisition and sequence analysis
[0033] 1) Extraction, quality inspection and first-strand synthesis of total cDNA from salivary gland RNA of brown planthopper;
[0034] 2) Synthesized by polymerase chain reaction (PCR) from the first strand of total cDNA Nl1860 CDS Fragment
[0035] Upstream primer (SEQ ID NO.3): 5'- TGTAGGAATTGAGCAGCAAG -3'
[0036] Downstream primer (SEQ ID NO.4): 5'- ATAAATTCTTTGGTGCATCC -3'
[0037] PCR amplification conditions: 94°C×3min→(94°C×30sec→55°C×30sec→72°C×1min30sec)×30 cycles→72°C×10min, to obtain specific PCR amplification products see appendix figure 1 .
[0038] 3) pMD19- Nl1860 Cloning vector construction and gene base analysis
[0039] The PCR product was cloned into the pMD19-T vector of Takara Company to obtain pMD19- Nl1860 carrier, and through CaCl 2 Transformed into TG1 Escherichia coli, containing pMD19- Nl1860 The carrier TG1 bacterial liquid was sent to Nanjing GenScript Company for s...
Embodiment 2
[0040] Embodiment 2, brown planthopper Nl1860 dsRNA synthesis and injection RNAi effect
[0041] 1) From the above pMD19- Nl1860 Obtained by polymerase chain reaction (PCR) in the cloning vector Nl1860 The middle 215bp fragment, and continue to synthesize Nl1860 dsRNA fragments. At the same time with GFP Plasmid as template, obtained by PCR GFP The middle 860bp fragment, and continue to synthesize GFP dsRNA fragment
[0042] ds Nl1860 -T7-F (SEQ ID NO.5):
[0043] 5’- GGATCCTAATACGACTCACTATAGGGCACGCTAAGCAACTCTT-3’
[0044] ds Nl1860 -T7-R (SEQ ID NO.6):
[0045] 5’-GGATCCTAATACGACTCACTATAGGACTCGTTCGGTCTGTCCT-3’
[0046] ds GFP -T7-F (SEQ ID NO. 7):
[0047]5'-GGATCCTAATACGACTCACTATAGGAAGGGCGAGGAGCTGTTCACCG-3'
[0048] ds GFP- T7-R (SEQ ID NO.8):
[0049] 5'-GGATCCTAATACGACTCACTATAGGCAGCAGGACCATGTGATCGCGC-3'
[0050] PCR amplification conditions:
[0051] Nl1860 : 94℃×3min→(94℃×30sec→62℃×30sec→72℃×30sec)×30 cycles→72℃×10min
[0052] GFP : 94℃×3min...
Embodiment 3
[0067] Embodiment 3, transgene Nl1860 Studies on the function of dsRNA against insects in rice
[0068] 1. Design forward and reverse primers, PCR amplify the 215bp long 625th to 839th Nl1860 genetic DNA fragment.
[0069] 2. DNA subcloning Nl1860 The gene fragment is inserted into the pMECE vector forward and reverse at the same time, and the forward and reverse connections are obtained. Nl1860 Gene fragment RNAi expression vector pMECE- Nl1860 ( Figure 6 ).
[0070] 3. Add pMECE- Nl1860 , into Agrobacterium EHA105 by electric shock method to obtain Agrobacterium engineered cell line. The rice callus was infected by Agrobacterium transfection method, and the co-infected rice callus was cultured on NBDS medium containing hygromycin, and the first selection was 20 days. After the new resistant callus grows, the resistant callus is stripped from the parent body and transferred to a new selection medium NBDS2, and one resistant callus is a strain. After the resistant c...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com