Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Specific trichomonas vaginalis nested PCR (Polymerase Chain Reaction) detection kit

A technology of trichomonas vaginalis and detection kit, which is applied to the determination/testing of microorganisms, methods based on microorganisms, DNA/RNA fragments, etc., to achieve the effect of improving sensitivity, high sensitivity, and simple and easy operation

Inactive Publication Date: 2014-04-30
JILIN UNIV
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there is no clinical application of Trichomonas vaginalis PCR detection kit

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Specific trichomonas vaginalis nested PCR (Polymerase Chain Reaction) detection kit
  • Specific trichomonas vaginalis nested PCR (Polymerase Chain Reaction) detection kit
  • Specific trichomonas vaginalis nested PCR (Polymerase Chain Reaction) detection kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Trichomonas vaginalis specific detection and diagnosis sequence: Trichomonas vaginalis G3 adhesion protein AP51-3 partial gene sequence. See Sequence Listing 1.

Embodiment 2

[0038] According to Example 1 Trichomonas vaginalis G3 adhesion protein AP51-3 partial gene sequence design specific nested PCR detection primers are as follows:

[0039] f 1 :GCCCGTAACTTCAACATCC

[0040] R 1 : TCCTCAACACCGTTCTCGT

[0041] f 2 : AAGGCTCAGGTCTACTGTGGT

[0042] R 2 : ATTGTCTGGGCAACTTCCTCT;

[0043] The above two primers can amplify specific detection gene fragments in different systems (nested PCR), the target bands are bright, and there are no non-specific bands. Realize the purpose of detecting Trichomonas vaginalis.

Embodiment 3

[0045] Trichomonas vaginalis PCR detection kit, the composition structure is as follows:

[0046] (1) DNA lysis solution: a mixed solution containing different concentrations of NaCl, Tris-HCl, EDTA, SDS and proteinase K. The ratio of each concentration is: NaCl 100mM, Tris-HCl (pH 7.5) 20Mm, EDTA 25Mm, SDS 2% (w / v) and proteinase K 0.1μg / μl. The function of the lysate is to lyse the nucleated cells (leukocytes, epithelial cells, etc.) in the urine and digest the proteins in them to release the genomic DNA.

[0047] (2) PCR reaction solution: 4 kinds of dNTPs with a final concentration of 100-300 μM each, primer F with a final concentration of 10-100 pmol / μl 1 R 1 f 2 R 2 , 1.5-4.5mM Mg 2+ concentration. Add 2.0 U of Taq enzyme to each PCR reaction (20 μl), and the reaction solution does not contain Taq enzyme.

[0048] (3) Positive control: The positive control used in the kit of the present invention is Trichomonas vaginalis genomic DNA, and its function is to comp...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a specific trichomonas vaginalis nested PCR (Polymerase Chain Reaction) detection kit which is used in diagnosis and detection of trichomonas vaginalis. A trichomonas vaginalis G3 attachment protein AP51-3 gene diagnosis sequence is provided, a primer is designed according to the sequence, the sensitivity is improved through optimizing an amplification condition, and an amplification result is directly observed through electrophoretic analysis. The nested PCR detection kit is precise in design, simple and easy to operate, high in sensitivity, strong in specificity, capable of identifying trichomonas vaginalis infection, and accurate and objective in result determination.

Description

technical field [0001] The invention relates to the diagnosis and detection technology of Trichomonas vaginalis, more precisely, provides a specific Trichomonas vaginalis nesting PCR detection kit, which belongs to the technical field of parasite detection. Background technique [0002] Trichomoniasis vaginalis is a non-viral sexually transmitted disease caused by Trichomonas vaginalis. Trichomonas vaginalis mainly causes genitourinary system diseases in men and women; it can also cause miscarriage, premature delivery, premature rupture of membranes, low birth weight infants and perinatal infection in pregnant women; in addition, Trichomonas vaginalis infection can increase the risk of HIV, gonorrhea, etc. The probability of infection of spreading diseases can increase the incidence of cancer in women. [0003] The culture method of Trichomonas vaginalis serves as the gold standard for diagnosis. Diamond's medium is a relatively perfect method for cultivating Trichomonas v...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12Q1/04C12N15/11C12R1/90
CPCC12Q1/6848C12Q1/04C12Q1/686C12Q2549/119C12Q2531/113
Inventor 张西臣于艳辉李建华宫鹏涛王力刘丽张国才杨举张楠李赫杨正涛
Owner JILIN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com