Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method and primers for detecting mutation site of exon 5 of runx1 gene

A technology of mutation sites and exons, which is applied in the fields of life sciences and biology, can solve the problems of single and low abundance of non-specific amplification products, and achieve the effects of simple operation, low cost, and improved amplification specificity

Active Publication Date: 2016-06-08
SHENYANG ADICON CLINICAL LAB CO LTD
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Touch-down PCR amplification can ensure that the combination of the forward and reverse amplification primers and the sample DNA template occurs between the most complementary sequences. When the annealing temperature is reduced to the level where non-specific amplification occurs, the specific amplification product is here When there is already a geometric number of initial advantages, the abundance is high. In the remaining amplification reactions, the specific amplification products compete with the non-specific amplification products, but because the abundance of non-specific amplification products is low, Specific amplification products are always preferentially amplified, resulting in a single dominant specific amplification product

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method and primers for detecting mutation site of exon 5 of runx1 gene
  • Method and primers for detecting mutation site of exon 5 of runx1 gene
  • Method and primers for detecting mutation site of exon 5 of runx1 gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] Primers for detecting the mutation site of exon 5 of RUNX1 gene, including: forward and reverse primers for amplifying the mutation site of exon 5 of RUNX1 gene; its base sequence is:

[0045] RUNX1-exon5-F: ATTAATGATTGGTTATTCAACAG

[0046] RUNX1-exon5-R: AATCTGAGACATGGTCCCTG.

[0047] Preferably, the primers also include a pair of sequencing primers, the base sequence of which is

[0048] RUNX1-exon5-S-F: ATTAATGATTGGTTATTCAACAG

[0049] RUNX1-exon5-S-R: AATCTGAGACATGGTCCCTG.

[0050] In the detection, first use the above-mentioned forward and reverse primers to amplify the mutation site of exon 5 of the RUNX1 gene to obtain the amplified product, and then use the above-mentioned pair of sequencing primers to sequence the amplified product to obtain the amplified product gene sequence.

[0051] The kit for detecting the mutation site of exon 5 of the RUNX1 gene, including: sample DNA extraction reagent (for example, use the kit of Tiangen Bio to extract sample DNA)...

Embodiment 2

[0063] Detection process:

[0064] (1) Use blood DNA extraction kit (Tiangen Bio) to extract genomic DNA from blood samples:

[0065] 1) Take 500uL of blood and add 1000uL of red blood cell lysate, mix by inversion, and let stand at room temperature for 5 minutes, during which time, invert and mix several times. Centrifuge at 3000rpm for 5min, suck off the supernatant, leave the white blood cell pellet, add 200uL buffer GA, shake until thoroughly mixed.

[0066] 2) Add 20 μl proteinase K solution and mix well.

[0067] 3) Add 200 μl of buffer GB, mix thoroughly by inversion, place at 70°C for 10 minutes, the solution should become clear, and briefly centrifuge to remove water droplets on the inner wall of the tube cap.

[0068] 4) Add 200 μl of absolute ethanol, vortex and mix well for 15 seconds. At this time, flocculent precipitates may appear. Briefly centrifuge to remove water droplets on the inner wall of the tube cap.

[0069] 5) Add the solution and flocculent precip...

Embodiment 3

[0095] The nucleic acid detection kit of the present invention is used to detect clinical samples.

[0096] Twenty cases of anticoagulated blood samples from patients with acute myeloid leukemia (AML) were taken, and the genomic DNA in the samples was extracted according to the detection process described in Example 2, and reagents were prepared and tested.

[0097]Add 2 ul of the genomic DNA solution of each sample extracted according to the detection process described in Example 2 into the PCR reaction solution of the detection system. Do positive, negative and blank controls at the same time. A 96-well ordinary PCR machine can detect 46 samples at the same time. Each sample is repeated twice, one positive control, one negative control and one blank control. The detection time is 160 minutes.

[0098] After the amplification product of genomic DNA of each sample is sequenced twice by Sanger, compare the sequencing sequence obtained by the PCR amplification product of exon 5...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method and primers for detecting a fifth exon mutation site of a RUNX1 gene. The method and the primers comprise a forward primer, a reverse primer and a pair of sequencing primers for amplifying the fifth exon mutation site of the RUNX1 gene. The method combines a Touch-down PCR amplification and a Sanger sequencing method, can rapidly detect mutation conditions of the fifth exon mutation site of the RUNX1 gene in an acute myeloid leukemia patient body.

Description

technical field [0001] The invention belongs to the field of life science and biotechnology, in particular to a method and primers for detecting the mutation site of the fifth exon of RUNX1 gene. Background technique [0002] Acute myeloid leukemia (AML) is a malignant disease caused by cumulative acquired gene changes in myeloid hematopoietic stem / progenitor cells, resulting in changes in cell proliferation, differentiation and apoptosis pathways. [0003] RUNX1, also known as AML1, is a member of the RUNX transcription factor protein family and is the most common target site of leukemia chromosomal translocation. RUNX1 is a very important transcription factor that can bidirectionally (promote or inhibit) regulate hematopoietic-related factors, thereby regulating the differentiation, apoptosis and self-renewal of hematopoietic stem cells. RUNX1 point mutations can often occur in myelodysplastic syndrome (MDS), AML, chronic myelomonocytic leukemia (CMML), and less commonly ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/686C12Q1/6869C12Q2531/113C12Q2535/101
Inventor 李文静周晓犊王淑一
Owner SHENYANG ADICON CLINICAL LAB CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com