Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Recombination gene expression system of mortierella alpina and construction method and applications thereof

A kind of Mortierella alpine, gene technology, applied in the field of bioengineering

Active Publication Date: 2014-02-12
JIANGNAN UNIV
View PDF4 Cites 35 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the lack of an effective recombinant gene expression system, this theory has not been verified and applied in Mortierella alpina

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombination gene expression system of mortierella alpina and construction method and applications thereof
  • Recombination gene expression system of mortierella alpina and construction method and applications thereof
  • Recombination gene expression system of mortierella alpina and construction method and applications thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0058] Example 1: Bioinformatics analysis of Mortierella alpina ATCC32222 genome

[0059] According to the genome information of Mortierella alpina ATCC32222 (DDBJ / EMBL / GenBank accession ADAG00000000, first version ADAG01000000), the protein coding sequence predicted by BLAST against the protein database NR( www.ncbi.nlm.nih.gov), KOGs and COGs, KEGG, UniRef100 and Swiss-Prot, BRENDA search comparison. Protein structure databases were compared using InterProScan. The full-length 654bp coding sequence of the ura5 gene encoding OPRTase was predicted. The predicted malE1 gene coding sequence encoding ME1 is 1752bp in length. The predicted coding sequence of the malE2 gene encoding ME2 is 1857 bp in length.

Embodiment 2

[0060] Embodiment 2: Mortierella alpina total RNA extraction

[0061] (1) Take out an appropriate amount of bacteria frozen in liquid nitrogen and grind them thoroughly in a sterile, enzyme-free mortar.

[0062] (2) Add 1 mL of TRIzol (Invitrogen, Carlsbad, CA, USA) reagent and continue grinding, then place at room temperature until dissolved.

[0063] (3) Pipette 1 mL of the liquid in (2) into an enzyme-free centrifuge tube, add 200 μL of chloroform and mix well.

[0064] (4) Centrifuge at 12000rpm at 4°C for 15min and aspirate the supernatant into a new enzyme-free centrifuge tube.

[0065] (5) Add an equal volume of isopropanol, let stand for 15 minutes, centrifuge at 12,000 rpm, 4°C for 15 minutes.

[0066] ⑹ Use the tip of the non-enzyme pipette to suck out the isopropanol and dry it as much as possible.

[0067] (7) Wash the precipitate once with 70% ethanol, centrifuge at 12000rpm, 4°C for 15min.

[0068] (8) Dissolve total RNA in enzyme-free water and store at -80°...

Embodiment 3

[0071] Example 3: Obtaining ura5 gene, malE1 gene and malE2 gene and IT fragment

[0072] (1) Take 0.5-1 μg of total RNA as a template, and operate according to the instructions of the PrimeScript RT reagent kit (TaKaRa, Otsu, Shiga, Japan) to obtain the cDNA of Mortierella alpina.

[0073] (2) According to the results of genome bioinformatics analysis, design primers for the predicted coding sequences of ura5 gene, malE1 gene, malE2 and IT gene (restriction sites are underlined):

[0074] URA5F:ACA TCATGA CCATCAAGGAATACCAGCGCG

[0075] URA5R: TCG GGATCC CTAAACACCGTACTTCTCC

[0076] malE1F: CATGCG TCATGA CTGTCAGCGAAAACACC

[0077] malE1R:TACGC GGATCC TTAGAGGTGAGGGGCAAAGG

[0078] malE2F:ATCGG GGTACC ATGTTGAGGAATCCTGCTCTCA

[0079] malE2R:TAATTCC CCCGGG TCAGGGGTGCGATTCCAG

[0080] ITF: GCATG CCATGG AG AAGCTTGGTACCGCTAGC TCCCAAGCGAATTTGTCATCTCG

[0081] ITR: CGC GGATCCGAGCTCCCCGGG GGA CTCGAG AGCATACGGAAGTCCATCAGTTACG

[0082] (3) Using cDNA as a templa...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a recombination gene expression system of mortierella alpina (Mortierella alpina ATCC 32222) and applications thereof. According to the invention, by taking mortierella alpina ATCC 32222 uracil auxotroph strains as materials, a set of recombination gene expression system of mortierella alpina is constructed through carrying out genetic manipulation by using an agrobacterium tumefaciens mediated genetic manipulation technique; and an operation is operated by using the system, so that multiple high-yield polyunsaturated fatty acid mortierella alpina strains are obtained, therefore, the recombination gene expression system of mortierella alpina and construction method and applications thereof disclosed by the invention are of great importance in the basic theory study and product development of oil-producing fungi mortierella alpina ATCC 32222.

Description

【Technical field】 [0001] The invention relates to a recombinant gene expression system of Mortierella alpina and its construction method and application, belonging to the technical field of bioengineering. 【Background technique】 [0002] Mortierella alpina is an important oleaginous filamentous fungus. It has the characteristics of high content of arachidonic acid (AA), safety, and reasonable composition of polyunsaturated fatty acids (PUFAs). It has been used in the industrial production of AA. At present, the research on high-yielding strains of Mortierella alpina mainly focuses on strain selection and optimization of fermentation conditions. Due to the lack of an efficient genetic operating system for Mortierella alpina, genetic modification of this highly valuable filamentous fungus is currently not possible. This constitutes an insurmountable obstacle for the basic theoretical research on the fatty acid synthesis pathway of Mortierella alpina and the construction of ge...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/15C12N15/80C12P7/64C12R1/645C12R1/01
CPCC12Y101/01038C12P7/6463C12N15/80C12N9/0006C12Y101/0104
Inventor 陈永泉陈卫郝光飞陈海琴郝丹辉赵山山赵建新顾震南张灏
Owner JIANGNAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com