Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Coenzyme-Q10-production engineered bacteria construction method, engineered bacteria, and application thereof

A construction method and technology of engineering bacteria, applied in the field of production of coenzyme Q10 engineering bacteria, achieving high application value and industrial practicability, low requirements for instruments and equipment, and increasing production

Active Publication Date: 2014-01-15
ZHEJIANG NHU CO LTD +1
View PDF1 Cites 19 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] At present, there is no patent related to the enhancement of the synthesis ability of coenzyme Q10 of Rhodobacter sphaeroides through the overexpression of UbiG gene

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Coenzyme-Q10-production engineered bacteria construction method, engineered bacteria, and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] 1. Construction of recombinant plasmids

[0038] 1. Design primers

[0039] Primer sequences were designed using Primer5 primer design software. Clone gene UbiG,

[0040] Upstream primer: CGGGATCCGCAATGGAATCGTCCAGCACC,

[0041] Downstream primer: CCCAAGCTTTCTGAGACGGGACCGGAAG,

[0042] The upstream primer added restriction site BamHI, and the downstream primer added restriction site HindIII.

[0043] 2. Extract the genome of Rhodobacter sphaeroides (all reagents used are from Biospin Bacterial Genomic DNA Extraction Kit)

[0044] 1) Aspirate 0.5-4mL bacteria (up to 5×109 bacteria), centrifuge at 13500rpm for 1 minute, and aspirate the supernatant as much as possible.

[0045] 2) Add 100 μL EL Buffer and pipette evenly with a tip.

[0046] 3) Incubate at 37°C for 40 minutes.

[0047] 4) Add 100μL RS Buffer, then add 10μL PK Solution, and mix well.

[0048] 5) Incubate at 56°C for 15 minutes, then remove.

[0049] 6) Add 200μL GA Buffer and mix well.

[0050]7) C...

Embodiment 2

[0105] Fermentation culture

[0106] First-class seeds: Pick a single clone of the NHU-ZUB strain and inoculate it in a 50-mL shake flask containing 10 mL of seed medium, at a rotation speed of 200 rpm, and incubate at 30°C for 23 hours.

[0107] Secondary seeds: transfer 1% of the first-grade seeds to a 50mL shake flask containing 20mL of seed medium, and cultivate them at 30°C and 200rpm for 23 hours to obtain the second-grade seeds.

[0108] Fermentation culture: inoculate 1% secondary seeds into 500mL containing 100mL fermentation medium, and culture at 30°C and 200rpm for 120h. Collect the bacterial liquid and extract coenzyme Q10.

experiment example

[0109] Experimental example: HPLC detection and comparison of Q10 yield comparison before and after strain transformation, see Table 1:

[0110] Table 1 Comparison of Q10 yield before and after strain transformation

[0111] strain type Coenzyme Q10 production original strain 2500mg / L NHU-ZUB strain 2950mg / L

[0112] From the above table, the coenzyme Q10 output of the transformed strain increased from 2500mg / L to 2950mg / L.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of biology, and discloses a coenzyme-Q10-production engineered bacteria construction method, engineered bacteria, and an application thereof. The method comprises the steps that: a, total genomic DNA is extracted from Rhodobacter sphaeroides cacterial liquid; b, UbiG gene is obtained by amplification with a polymerase chain reaction; c, the amplified UbiG gene is connected with broad-host plasmid, such that recombinant vector is constructed; d, the recombinant vector is transferred to Escherichia coli S17-1; and e, the Escherichia coli S17-1 is subjected to conjugal transfer with the Rhodobacter sphaeroides, such that the engineered bacteria are obtained. According to the method provided by the invention for improving coenzyme Q10 yield through regulating Rhodobacter sphaeroides aromatic ring modification pathway, the operation is simple, and coenzyme Q10 synthesis capacity can be improved by higher than 30%. The method is suitable for coenzyme Q10 large-scale industrial production.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a construction method for producing coenzyme Q10 engineering bacteria, engineering bacteria and applications thereof. Background technique [0002] Coenzyme Q is a fat-soluble quinone compound that widely exists in organisms. Coenzyme Q from different sources has different numbers of isopentenyl units in its side chain. Humans and mammals have 10 isopentenyl units, so it is called coenzyme Q10. As shown in formula (I): [0003] [0004] Coenzyme Q10 is an important hydrogen transporter in the respiratory chain of biological cells and a good biochemical drug. In recent years, it has been widely used in the treatment of various diseases such as heart disease, diabetes, cancer, acute and chronic hepatitis, and Parkinson's disease. In addition, it also has significant effects in treating scurvy, duodenal ulcer, necrotizing periodontitis, and promoting pancreatic function and secretio...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/74C12N1/21C12P7/66C12R1/19C12R1/01
Inventor 于洪巍石一军陆文强晏文武石春晓
Owner ZHEJIANG NHU CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com