Volvaria volvacea V14 strain molecular specific detection markers and detection method

Abstract

The invention relates to a volvaria volvacea V14 strain molecular specific detection markers and a detection method thereof. The specific detection markers are V14F: GAGCAACCGAACCTCAACAACAC and V14R: CGCCGTGTCCGTTCATACCAAGC. The detection method comprises the steps that: the volvaria volvacea V14 strain is inoculated to a PDA plate medium, and is cultured for 3-5 days under a temperature of 32 DEG C; surface mycelium is scraped and placed into a sterile centrifuge tube; genome DNA is extracted by using an improved CTAB method, such that DNA is obtained; the extracted DNA is adopted as a template, the specific detection marker primers are adopted as amplification primers, and PCR amplification is carried out, such that a PCR amplification product is obtained; and electrophoresis is carried out. Compared with conventional morphological test, antagonism test, and fruiting test, the method provided by the invention has the advantages of short detection time and high accuracy.

Description

technical field [0001] The invention belongs to the field of straw mushroom strain labeling and detection, and in particular relates to a molecular-specific detection label and a detection method of the straw mushroom V14 strain. Background technique [0002] Straw mushroom (Volvariella volvacea) cultivation originated in China, has a cultivation history of more than 300 years so far, and is widely cultivated in southern my country. Straw mushrooms are delicious, not only rich in nutritional value, but also have an important role in health care, and are deeply loved by consumers. Straw mushroom is a high-temperature cultivated edible fungus. Compared with other edible fungi, its remarkable feature is that its growth rate is extremely fast. It usually only takes 2 weeks from sowing to harvesting. Its annual output has always ranked first in my country's edible fungi industry. Top ten. [0003] The hyphae of variola volvacea do not have lock-like associations. In classical ge...

AI Technical Summary

Problems solved by technology

[0003] The hyphae of variola volvacea do not have lock-like associations. In classical genetic studies, variola volvacea is the only basidiomycete identified as belonging to the primary homothalmic union reproduction mode among edible fungi. Although the whole genome sequence of the V23 strain has been At present, there are still many controversies about the genetics research of V. volvulus, especially the research on reproductive mode.

These studies have not yet clearly ascertained the mode of sexual reproduction of straw mushrooms. The lack of basic theoretical research has restricted the development of straw mushroom breeding and brought many difficulties to the selection and breeding of new varieties of straw mushrooms.

Images