Recombinant protein of antigen to porcine circovirus and antigen to porcine reproductive and respiratory syndrome virus, and preparation method and application of recombinant protein
A technology for porcine circovirus and respiratory syndrome, which is applied in the field of veterinary medicine, can solve the problems of low protection rate and unsatisfactory vaccine immunization effect, and achieve the effect of stable nature.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0041] 1. Modification and synthesis of nucleic acid sequences
[0042] Two antigen epitopes were selected through the nucleotide sequences of PCV2 and PRRSV published by GeneBank, and the two antigens were linked together by a flexible Linker. The target nucleotide sequence is as follows:
[0043] PCV2 nucleotide sequence fragment, as shown in SEQ ID NO: 1:
[0044] GGCATCTTCAACACCCGCCTCTCCCGCACCTTCGGATATACTATCAAGCGAACCACAGTCAAAACGCCCTCCTGGGCGGTGGACATGATGAGATTCAATATTAATGACTTTCTTCCCCCAGGAGGGGGCTCAAACCCCCGCTCTGTGCCCTTTGAATACTACAGAATAAGAAAGGTTAAGGTTGAATTCTGGCCCTGCTCCCCGATCACCCAGGGTGACAGGGGAGTGGGCTCCAGTGCTGTTATTCTAGATGATAACTTTGTAACAAAG GCCACAGCCCTGACCTATGACCCCTATGTAAACTACTCCTCCCGCCATACCATAACCCAGCCCTTCTCCTACCACTCCCGCTACTTTACCCCCAAACCTGTCCTAGATTCCACTATTGATTACTTCCAACCGAACAACAAAAGAAATCAGCTGTGGCTGAGACTACAAACTGCTGGAAATGTAGACCACGTAGGCCTCGGCACTGCGTTCGAAAACAGTATATACGACCAGGAATACAATATCCGTGTAACCATGTATGTACAATTCAGAGAATTTAATCTTAAAGACCCCCCACTGAACCCT
[0045] PRRSV nucleotide sequence fragment,...
Embodiment 2
[0058] The purified recombinant protein was emulsified with Freund's adjuvant, specifically, the recombinant protein with a concentration of 80 μg / mL was mixed with an emulsifier at a ratio of 1:1 by volume and then emulsified. The product after emulsification is immunized with PRRSV and PCV2 antigen, and antibody test is negative 21 days old piglets, and inoculation dose is 80mg / head; Piglets were immunized as a control; 1 week, 2 weeks, 3 weeks and 4 weeks after immunization, the piglets were subjected to venous blood collection respectively, and the serum was separated; commercially available ELISA kits were used to detect the antibody OD values of PRRSV and PCV2 in the serum (see Table 1 , Table 2), it was found that both PCV2 and PRRSV antibodies were positive after two weeks of immunization, and the PCV2 antibody was strongly positive.
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com