Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Rice adventitious root control gene ARLR1 and application thereof

A gene and rice technology, which is applied in the field of transgene recovery and RNAi technology experimental identification of the gene, can solve the problems of poor tissue morphology and fragmented related information

Inactive Publication Date: 2013-04-17
ZHEJIANG UNIV
View PDF0 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The molecular level research is far less than the histomorphological research. So far, although several genes have been reported to affect the occurrence and development of adventitious roots, the relevant information is still relatively fragmented

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Rice adventitious root control gene ARLR1 and application thereof
  • Rice adventitious root control gene ARLR1 and application thereof
  • Rice adventitious root control gene ARLR1 and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0051] Embodiment 1, ARLR1 gene cloning, identification

[0052]The genes of wild type (WT, Imperata chinensis can be purchased from the seed bank of China Rice Research Institute), arl1 mutant (screened by our laboratory) and ARL1 enhanced expression material (ARL1OV) (created by our laboratory) were analyzed by gene chip expression differences, and found that the gene ARLR1 was up-regulated in the ARL1-enhanced expression material and down-regulated in the mutant ( figure 1 ), this result was also verified by quantitative RT-PCR (qRT-PCR) ( figure 1 ). The qRT-PCR experiment uses Roche's Real Time PCR special reagent LightCycler? 480 SYBR Green I Master, and the PCR reaction is carried out on the LightCycler ? 480 (Roche, USA) quantitative PCR instrument. We cloned the gene by PCR method. Sequencing analysis showed that the sequence of the coding region of the gene as shown in SEQ ID NO: 1 is 1368bp (including stop codon), encoding a protein containing 455 amino acids as ...

Embodiment 2

[0054] Embodiment 2, rice transgenic

[0055] The rice genetic transformation system mediated by Agrobacterium bacterium (EHA105) was optimized based on the method reported by Hiei et al. (1994). The specific process is as follows:

[0056] Preparation of rice mature embryo callus:

[0057] After husking the mature seeds of rice (Imperata chinensis, SSBM), select the plump, smooth seeds without bacteria spots and put them into a beaker, and disinfect them with 70% (volume ratio concentration) alcohol for 2 minutes;

[0058] Pour off the alcohol and add 25% (v / v) NaClO solution to disinfect for 30 minutes;

[0059] Pour off the NaClO solution, wash 5 times with sterile water, and soak in sterile water for 30 minutes for the last time;

[0060] Pour off the sterile water, put the seeds on sterile filter paper to blot dry, put the seeds flat in the mature embryo induction medium of indica rice, and culture them in the dark at 28°C for 10 days;

[0061] Open the petri dish on ...

Embodiment 3

[0099] Example 3, Enhanced expression of ARLR1 gene in arl1 mutant

[0100] Enhanced expression vector P 35S ::Build of ARLR:

[0101] The full-length cDNA sequence of ARLR (shown in SEQ ID NO: 1) was cloned by PCR amplification method. The primer sequences are as follows, and KpnI and XbaI recognition sites (underlined) are added to the ends of the upstream and downstream primers respectively.

[0102] Upstream primer: 5′AAAA GGTACC ATGCAGCAGCAGCAGCAG 3′

[0103] Downstream primer: 5′ACGA TCTAGA TCAGAACTCCGGCAAGAACTCCGT 3′

[0104] The template used in the PCR reaction was: 7-day-old seedling SSBM wild-type cDNA, and the polymerase used was PrimeSTAR HS DNA Polymerase (Baosheng Company).

[0105] The PCR system is: DNA 100 ng, upstream primer 0.2μM, downstream primer 0.2μM, 10X PCR buffer 2μl, dNTP 0.2mM, TAQ DNA polymerase 1U (Baosheng), add ddH 2 0 to 20 μl.

[0106]The PCR reaction program was: denaturation at 98°C for 30 sec; 10 sec at 98°C, 7 sec at 60°C, 90 sec...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a protein encoded by a rice adventitious root control gene ARLR1, which is the amino sequence represented by SEQ ID No: 2. The invention synchronously discloses a gene encoding the protein, wherein the nucleotide sequence of the gene accords with the sequence represented by SEQ ID No:1. The invention also discloses a method for transforming the rice adventitious root generating capacity, comprising steps of transforming rice cells by the gene and cultivating the transformed rice cells to be plants. The invention finds out that the AGC group gene ARLR1 has the function in controlling the growth of the rice adventitious root for the first time, and the ARLR1 is the downstream gene of ARL1. Due to that fact that the normal generation and growth of the adventitious root is essential to hold the growth and development and high and stable yield of the plants of a fibrous root system, the gene has great utilization potentiality in molecular breeding.

Description

technical field [0001] The invention belongs to the field of plant genetic engineering. Specifically, the present invention relates to a rice ARLR1 (Adventitious rootless 1 recovery 1) gene cloned by a reverse genetics approach, as well as the experimental identification of the gene through transgene restoration and RNAi technology; Root structure improves crop yield. Background technique [0002] The root system is an important organ for plants to anchor and absorb water and nutrients from the soil. The root system of plants can be mainly divided into tap root system and fibrous root system. The root system of fibrous plants consists of seed roots, adventitious roots and lateral roots, and adventitious roots are the most important components of the root system of fibrous plants. Rice is one of the main food crops in the world, and it is also a model plant for fibrous root plants. [0003] Adventitious roots are postembryonic organs that arise at the stem nodes of rice. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/12C12N15/54C12N15/84A01H5/00C12N5/10
Inventor 毛传澡吴平刘绍军任美燕马孝霞吴运荣
Owner ZHEJIANG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com