Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

AKT3 gene mutation detection specificity primer and liquid chip thereof

A detection solution and specificity technology, which is applied in the field of molecular biology, can solve problems such as unusable and unsuitable for practical applications, and achieve the effects of increased sensitivity, accurate and reliable detection results, and overcoming low sensitivity

Active Publication Date: 2013-03-27
SUREXAM BIO TECH
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The PCR-RFLP method is based on the change of the restriction endonuclease recognition site caused by gene mutation, such as the loss of the site or the generation of a new site, a specific fragment is amplified by PCR, and then cut and amplified with a restriction endonuclease. Amplify the product and observe the size of the fragment by electrophoresis. This method is used to detect gene mutations with altered restriction sites, and can directly determine the genotype. However, this method cannot be used for the detection of gene mutations without new restriction sites.
Again, the above methods all have limitations in detection throughput, and can only detect one mutation type at a time, which cannot meet the needs of practical applications.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • AKT3 gene mutation detection specificity primer and liquid chip thereof
  • AKT3 gene mutation detection specificity primer and liquid chip thereof
  • AKT3 gene mutation detection specificity primer and liquid chip thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0019] Example 1 AKT3 gene mutation detection liquid chip mainly includes:

[0020] 1. ASPE Primers

[0021] Specific primer sequences were designed for the wild-type and mutant types of the common genotype G171R of the AKT3 gene. ASPE primers consist of "tag sequence + specific primer sequence". ASPE primer sequences are shown in the table below:

[0022] Table 1 The tag sequence in the ASPE primer sequence of AKT3 gene

[0023] SEQ ID NO.

tag sequence

[0024] 1

CAATAAACTATACTTCTTCACTAA

2

TCAAAATCTCAAATACTCAAATCA

3

CTTTTCAATTACTTCAAATCTTCA

4

ATTATTCACTTCAAACTAATCTAC

5

CTTTTCATCTTTTCATCTTTCAAT

6

CTTTCAATTACAATACTCATTACA

[0025] Table 2 The specific primer sequence in the ASPE primer sequence of AKT3 gene

[0026]

[0027] Each ASPE primer includes two parts, the 5' end is a specific tag sequence for the anti-tag sequence on the corresponding microsphere, and the...

Embodiment 2

[0040] Example 2 Detection of samples using AKT3 gene detection liquid chip

[0041] The formula of described various solutions is as follows:

[0042] 50mM MES buffer (pH5.0) formula (250ml):

[0043]

[0044] 2×Tm hybridization buffer

[0045] Reagent

[0046] Store at 4°C after filtration.

[0047] ExoSAP-IT kit was purchased from US USB Company.

[0048] Biotin-labeled dCTP was purchased from Shanghai Sangon Bioengineering Technology Service Co., Ltd.

[0049] 1. Sample DNA extraction:

[0050] Refer to the relevant methods of DNA extraction in "Molecular Cloning" to obtain the DNA to be detected.

[0051] 2. PCR amplification of samples to be tested

[0052] A pair of primers were designed, and a target sequence containing the common genotype G171R of the AKT3 gene was amplified by PCR. The product sizes were 388bp. The primer sequences (SEQ ID NO.7-8) are shown in Table 4 above.

[0053] First prepare the multiplex PCR primer working solution: take 100u...

Embodiment 3

[0089] Example 3 Detection of AKT3 gene SNP site by liquid chip with different ASPE primers

[0090] 1. Design of liquid phase chip preparation (selection of tag sequence and Anti-tag sequence)

[0091] Taking the AKT3 gene G171R site mutation detection liquid chip as an example, the specific primer sequence of the 3' end of the ASPE primer was designed for the wild type and mutant type of G171R, and the tag sequence of the 5' end of the ASPE primer was selected from SEQ ID NO.1 - SEQ ID NO.6, correspondingly, the anti-tag sequence coated on the microspheres and complementary to the corresponding tag sequence is selected from SEQ ID NO.9-SEQ ID NO.14. The specific design is shown in the following table (Table 8). The synthesis of ASPE primers, microspheres coated with anti-tag sequences, amplification primers, detection methods, etc. are as described in Example 1 and Example 2.

[0092] Table 8 Design of liquid phase chip preparation

[0093]

[0094]

[0095] 2. Samp...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an AKT3 gene mutation detection specificity primer and a liquid chip thereof. The liquid chip mainly comprises: an ASPE primer composed of a 5'-terminal tag sequence and a 3'-terminal specificity primer sequence focused on a target gene mutation site, wherein the specificity primer sequence comprises SEQ ID NO.7 and SEQ ID NO.8 focused on a G171R site; a microsphere coated by an anti-tag sequence; and an amplimer. The consistency between the detection result of the detection liquid chip provided by the invention and the detection result of a sequencing method is high to 100%, and the wild-type and mutant parallel detection of a plurality of mutation sites is realized.

Description

technical field [0001] The invention belongs to the field of molecular biology, relates to medicine and biotechnology, in particular to a specific primer for AKT3 gene mutation detection and a liquid phase chip. Background technique [0002] AKT is the human homologous gene of the viral oncogene v-akt, which encodes serine threonine protein kinase, plays an important role in PI3K-related signaling pathways, affects cell survival, proliferation and invasion, and participates in cell apoptosis and glucose cellular processes including metabolism. [0003] Current studies have shown that in lung cancer and breast cancer, AKT gene activation is significantly related to chemotherapeutic drug resistance. The therapeutic effect-related mutations of the AKT3 gene mainly include G171R, and the G171R (511G>A) mutation is a glycine mutation encoded by the 171st codon For arginine, AKT3 gene mutation has become a hotspot in drug efficacy research. [0004] At present, there are few ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11
Inventor 许嘉森郭靖罗小笛
Owner SUREXAM BIO TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com