Potassium ion concentration detection method
A potassium ion concentration and concentration technology, applied in the field of biomedicine, can solve problems such as complex operation and large error
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0068] The DNA capable of forming a G quadruplex used in this example is AGGGTTAGGGTTAGGGTTAGGG, and the cyanine dye used is a compound of the following formula
[0069]
[0070] 1) Prepare standard solution samples and test solutions
[0071] A certain amount of DNA was dissolved in Tris-HCl buffer solution with a pH value of 6.2 to prepare a DNA stock solution with a concentration of 200 μmol / L for later use.
[0072] Take 300 μL of methanol solution with a concentration of 200 μmol / L cyanine dye, add 19.2 ml of Tris-HCl buffer, and then add 300 μL of DNA solution and mix well. Divide the above sample into 10 parts on average, each sample solution is 1.98mL.
[0073] Take 6 samples among them, add a certain amount of KCl solution with a concentration of 200mmol / L, and then use Tris-HCl buffer solution to make the volume to 2mL, and the concentrations of potassium ions are 0, 0.05, 0.1, 0.25, 0.5, 0.8mmol / L standard solution sample.
[0074] Add 20 μL of the urine sampl...
Embodiment 2
[0083] The DNA capable of forming a G quadruplex used in this example is TGAGGGTGGGGAGGGTGGGGAA DNA, and the cyanine dye used is a compound of the following formula
[0084]
[0085] 1) Prepare standard solution samples and test solutions
[0086] A certain amount of DNA was dissolved in boric acid-borax buffer solution with a pH value of 8.2 to prepare a DNA stock solution with a concentration of 200 μmol / L for later use.
[0087] Take 300 μL of methanol solution with a concentration of 600 μmol / L cyanine dye, add 19.2 ml of boric acid-borax buffer, and then add 300 μL of DNA solution and mix well. Divide the above sample into 10 parts on average, each sample solution is 1.98mL.
[0088] Take 6 samples among them, add a certain amount of KCl solution with a concentration of 200mmol / L respectively, and then use boric acid-borax buffer solution to set the volume to 2mL, and the concentrations of potassium ions are respectively 0, 0.05, 0.1, 0.25, 0.5, 0.8mmol / L standard so...
Embodiment 3
[0097] The DNA capable of forming a G quadruplex used in this example is GGGCCAGGGAGCGGGGCGGAGGGGG, and the cyanine dye used is a compound of the following formula
[0098]
[0099] 1) Prepare standard solution samples and test solutions
[0100] A certain amount of DNA was dissolved in Tris-HCl buffer solution with a pH value of 7.2 to prepare a DNA stock solution with a concentration of 600 μmol / L for later use.
[0101] Take 300 μL of methanol solution with a concentration of 1.2 mmol / L cyanine dye, add 19.2 ml of Tris-HCl buffer, and then add 300 μL of DNA solution and mix well. Divide the above sample into 10 parts on average, each sample solution is 1.98mL.
[0102] Take 6 samples among them, add a certain amount of KCl solution with a concentration of 200mmol / L, and then use Tris-HCl buffer solution to make the volume to 2mL, and the concentrations of potassium ions are 0, 0.05, 0.1, 0.25, 0.5, 0.8mmol / L standard solution sample.
[0103] Add 20 μL of the urine sa...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com