Chemiluminescent immunity imaging detection method of EV71 (Enterovirus) virus
A chemiluminescence immunoassay, imaging detection technology, applied in chemical instruments and methods, antiviral immunoglobulins, biochemical equipment and methods, etc., can solve the problems of long time, nucleic acid degradation, false negative test results, etc., and achieve easy operation. , high sensitivity and specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] 1. Preparation of EV71 whole virus rabbit anti-polyclonal antibody and virus VP1 protein rabbit anti-polyclonal antibody:
[0040] A pair of primers were designed according to the genome VP1 gene sequence of EV71 virus BrCr-TR strain (GenBank: AB204852.1), VP1-F: GAGAGTTCTATAGGGGACAGT, VP1-R: AGCTGTGCTATGTGAATTAGGAA, and the amplified fragment was 891bp. To facilitate the cloning of PCR products, a BamHI and SalI restriction site were added to the upstream and downstream primers, respectively. The primers were synthesized by Shanghai Sangon Bioengineering Co., Ltd. Extract EV71 virus HB0803 strain RNA, carry out PCR amplification after reverse transcription, obtain VP1 gene (see figure 1 ). The obtained PCR product recovered by DNA gel recovery kit (produced by Shanghai Sangon Bioengineering Co., Ltd.) was connected to vector pMD-18T (purchased from Dalian TaKaRa Company), and then transformed into Escherichia coli DH5α to obtain recombinant plasmid. The sequence det...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com