Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Recombinant phages influenza vaccine

A technology of influenza vaccine and phage, which is applied in the field of medical biology, can solve the problems of unsatisfactory immune effect, virus contamination, and easily outdated antigenicity, and achieve the effect of stable phage particles, low cost, and simple purification

Active Publication Date: 2007-08-15
INST OF MEDICAL BIOLOGY CHINESE ACAD OF MEDICAL SCI
View PDF1 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] In order to overcome the deficiencies of the existing influenza virus, such as extremely high mutation rate, virus contamination, easily outdated antigenicity, and unsatisfactory immune effect in influenza vaccines, the present invention provides a recombinant bacteriophage influenza vaccine with high immunity, safe and reliable

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant phages influenza vaccine
  • Recombinant phages influenza vaccine

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0070] A. Construction of recombinant phage

[0071] A DNA sequence was synthesized by a commercial company. The DNA sequence has been installed on the pGEM-T vector. The 5' end of the DNA sequence contains the restriction site EcoRI, and the 3' end contains the restriction site EcoRV. The DNA sequence encodes the following polypeptide: general Helper T cell epitope, encoded by the gene atgcaatacataaaagccaactcgaagttcataggaataacggaactc; 1-15 amino acid residues of the extracellular domain M2e of the highly conserved envelope protein M of influenza A virus, encoded by the gene atgagtcttctaaccgaggtcgaaacgccgataaggaacgagtgg; spacer GPGPG, encoded by the gene ggtccgggtccgggt; And the 1-21 amino acid residues of the highly conserved envelope protein BM2 of influenza B virus, the coding gene is atgctcgaaccatttcagattctttcaatttgttcttttatcttatcagctctccatttcatg; that is, this DNA sequence codes Th-M2e (1～15) -Spacer-BM2 (1～21) fusion protein.

[0072] Treat the recombinant pGEM-T vecto...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

This invention relates to the field of molecular biology and vaccinology, a phage display broad spectrum influenza vaccine, and further relates to preparation method of phage display broad spectrum influenza vaccine. Present influenza vaccine can not provide protect aim at different influenza virus owing to high Variation of influenza virus. The invention constructs a universal recombinant phage influenza vaccine by inserting extracellular region M2 coding gene of highly conserved Type An influenza virus envelope protein M and part coding gene of B influenza virus highly conserved envelope protein BM 2 to bacteriophage T7, and prepares to recombinant phage influenza microsphere vaccine. After protective inoculation, the vaccine can provide protective action against different hypotype of type Ainfluenza virus and type B influenza virus.

Description

[0001] The invention relates to an influenza vaccine, in particular to a recombinant bacteriophage influenza vaccine, and belongs to the technical field of medical biology. Background technique [0002] Influenza virus is highly contagious and can cause acute respiratory diseases. Its epidemic is characterized by sudden onset and rapid spread in a short period of time, resulting in different degrees of epidemics, including world pandemics, local outbreaks and sporadic, high incidence and with a certain mortality rate. The important reasons for repeated influenza epidemics are: (1) Due to the segmental nature of influenza genes, high mutation rate and frequent gene recombination, the immune variability is large, especially the hemagglutinin (HA) and neuraminic acid of influenza A virus. The variability of the acidase (NA) antigen is large; (2) Influenza is a zoonotic disease, and there are many subtypes of influenza A virus in animals, which can directly cause human influenza; ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K39/295A61K39/145C12N15/44C12N7/01A61P31/16A61P11/00
Inventor 胡云章胡凝珠瞿素
Owner INST OF MEDICAL BIOLOGY CHINESE ACAD OF MEDICAL SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com