Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Mutations associated with iron disorders

a technology of mutations and iron disorders, applied in the field of mutations associated with iron disorders, can solve the problems of tissue damage and functional impairment of organs, and achieve the effect of high iron absorption and elevated fasting transferrin saturation level

Inactive Publication Date: 2006-03-09
ROTHENBERG BARRY +2
View PDF39 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

"The invention is about a new method to diagnose iron disorders, such as hemochromatosis, by detecting mutations in a specific gene. These mutations are associated with elevated iron levels, ferritin levels, or percent saturation of transferrin. The method involves analyzing a sample of RNA or DNA from a mammal, such as a human patient, to determine if they have the mutation. The mutation is not a missense mutation at position 187 of SEQ ID NO:1. The invention provides a new way to diagnose iron disorders and can help with genetic susceptibility testing."

Problems solved by technology

Such iron deposition can lead to tissue damage and functional impairment of the organs.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Mutations associated with iron disorders
  • Mutations associated with iron disorders
  • Mutations associated with iron disorders

Examples

Experimental program
Comparison scheme
Effect test

example 1

Selection and Characterization of Subjects

[0038] All individuals studied were Caucasians, 18 years of age or older, and from central Alabama. Twenty probands were identified that were either heterozygous for C282Y or H63D, or lacked these mutations. Hemochromatosis is typically diagnosed by detecting elevated saturation of transferrin, with elevated serum ferritin levels, combined with liver biopsy. Each proband patient described below was previously diagnosed to have hemochromatosis by the working diagnostic criterion for hemochromatosis of the American College of Pathologists (elevated fasting transferrin saturation of greater than 60% saturation for males and greater than 50% saturation for females) on at least two occasions in the absence of other known causes. Probands were interviewed regarding their general medical history, diet (including estimated iron content and ethanol consumption), medicinal iron use, receipt of blood transfusion, prior significant hemorrhage, blood do...

example 2

HFE Gene Analysis

[0039] PCR amplification was used to detect mutations. Genomic DNA was prepared from peripheral blood buffy coat or saliva using the QIAmpBlood Kit (QIAGEN, Valencia, Calif.) or FTA Paper and FTA purification reagent (Fitzco Inc., Maple Plain, Minn.), respectively. Fragments were amplified from genomic DNA using eLONGase (Life Technologies, Gaithersburg, Md.) or HotStarTaq DNA polymerase (QIAGEN, Valencia, Calif.). Primers used to amplify each exon are shown in Table 3.

TABLE 4Human HFE genomic DNA1ggatcctttaaccgaggagattattatagccggagctctgaagcagcaatctcagttctt61gtgatagtgagcaaagaactacaaactaacaccaaaatgcaagcttaaagcaaagtttat121tgaagcacaataatacactctgagggacagcgggcttatttctgcgaagtgaactcagca181cttctttacagagctcaaggtgcttttatggggtttgtggggaggagttgaggtttgggc241tgtatctgagtgacaggatgatgttatttgattgaagtttatagctatacaatctaaaat301taaactgtgcatggtcttacctataatttgttaagaaaagcctcccagggatgggggggc361aaaactgtatgtaaattctattataatgatggcatgatgaacttggggtgaacttgaaga421caggcttttgtgttgttgggcatgtgccacctta...

example 3

Characterization of Probands

[0045] The mean age of the twenty probands was 44±11 years (range 27-62 years); thirteen (65.0%) were men and seven (35.0%) were women. Eleven had iron overload. One had hepatic cirrhosis, two had diabetes mellitus, four had arthropathy, and two had hypogonadotrophic hypogonadism. One proband also had hereditary stomatocytosis, another had beta-thalassemia trait, a third had ethanol intake >60 g daily, and a fourth had porphyria cutanea tarda. No proband had evidence of excess oral or parenteral iron intake, or of viral hepatitis B or C. At diagnosis of hemochromatosis, evaluation for common HFE mutations revealed that eleven probands were C282Y heterozygotes, five were H63D heterozygotes, and four did not inherit C282Y or H63D.

[0046] The mean age of the initial 176 control subjects was 52±15 years (range 18-86 years); 79 (44.9%) were men and 97 (55.1%) were women. There was no significant difference in the mean ages of men and women. Frequencies of HFE...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
concentrationaaaaaaaaaa
concentrationaaaaaaaaaa
hydrophobicaaaaaaaaaa
Login to View More

Abstract

The invention features a method of diagnosing an iron disorder, e.g., hemochromatosis, or a genetic susceptibility to developing such a disorder in a mammal by determining the presence of a mutation in exon 2 or in an intron of an HFE nucleic acid.

Description

BACKGROUND OF THE INVENTION [0001] Hemochromatosis is the most common progressive (and sometimes fatal) genetic disease in people of European descent. Hemochromatosis is a disease state characterized by an inappropriate increase in intestinal iron absorption. The increase can result in deposition of iron in organs such as the liver, pancreas, heart, and pituitary. Such iron deposition can lead to tissue damage and functional impairment of the organs. [0002] In some populations, 60-100% of cases are attributable to homozygosity for a missense mutation at C282Y in the Histocompatibility iron (Fe) loading (HFE) gene, a major histocompatibility (MHC) non-classical class I gene located on chromosome 6p. Some patients are compound heterozygotes for C282Y and another mutation at H63D. SUMMARY OF THE INVENTION [0003] The invention is based on the discovery of novel mutations which are associated with aberrant iron metabolims, absorption, or storage, or in advanced cases, clinical hemochroma...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(United States)
IPC IPC(8): C12Q1/68C07K14/705C12N15/13C12Q1/6883
CPCC12Q1/6883C12Q2600/158C12Q2600/156A61P3/00
Inventor ROTHENBERG, BARRYSAWADA-HIRAJ, RITSUKOBARTON, JAMES
Owner ROTHENBERG BARRY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com