Antiglyphosate gene and its use

A glyphosate-resistant, gene-resistant technology, applied in application, genetic engineering, plant genetic improvement, etc.

Inactive Publication Date: 2007-04-04
ZHEJIANG UNIV
View PDF1 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, whether the EPSPS of a species of bacteria is resistant to glyphosate and the level of resistance cannot be predicted by the amino acid sequence of the EPSPS

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] Embodiment 1, the screening of anti-glyphosate bacterial strain

[0023] Glyphosate-contaminated soil samples were cultured in M63 medium containing 50 mM glyphosate. Since M63 does not contain aromatic amino acids, the surviving and growing bacteria are resistant bacteria. The formula of the medium is as follows: (per liter of M63: 13.6g KH.sub.2PO.sub.4, 2g(NH.sub.4).sub.2SO.sub.4, 0.5mgFeSO.sub.4-7H.sub .2O, 2.4mg MgCl.sub.2, 10g glucose, 10mg Thiamine-HCl and 25mg L-Proline). One of the strains, named G3, was selected for its ability to grow in M63 medium containing 200 mM glyphosate.

Embodiment 2

[0024] Embodiment 2, the identification of resistant bacterial strain

[0025] Partial 16sRNA sequence was obtained by PCR. The primers for PCR are universal primers for 16s bacterial RNA. The PCR products were cloned into pMD18-T plasmid and sequenced. It was found that it was identical to Burkholderia caryophylli, Pseudomonas sp. 'FSL R1-057' (AF205137), bacteriumSV70AB2-1 (AY770429), Pseudomonas putida (AB 180734) (AM184283); sex. The strain is therefore a Pseudomonas sp G3.

Embodiment 3

[0026] The cloning of embodiment 3, EPSPS gene

[0027] According to the gene sequence data of Pseudomonas genome sequenced in the gene bank, a set of degenerate primers (PsR: 5'gacatsgcgatrcgrtgrtg; PsFa: 5'gasctgcgsgtcaaggarwsyga) were designed. The product obtained by PCR was cloned with pMD18-T and sequenced. It was found to be similar to EPSPSs whose genomes have been sequenced, such as Pseudomonas putida. Progress designed PCR primers to amplify the full-length EPSPS fragment (PsN: 5'tggcccgccgggcctatgtggacgctatgaac, PsC: 5'tgaccggtgcttgcgaactcacgact) based on the relevant genome sequencing results. The full fragment amplified by PCR was cloned into pMD18-T and sequenced by ABI 3700. The nucleotide sequence of this gene is SEQ ID NO: 1, named Gt-1.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

A roundup-resisting gene, its related protein polypeptide, protein, plasmid and plant cell and their uses are disclosed. The nucleotide sequence of the gene is SEQ ID NO:1 or SEQ ID NO:3. It has better roundup resistance and can remove weed selectively. It can be used to breed and culture plant cell.

Description

technical field [0001] The invention belongs to the field of plant genetic engineering, in particular, the invention relates to a glyphosate-resistant gene and a protein encoded by the gene. This gene can be used to express in plants to make plants resistant to glyphosate, so that glyphosate can be used to selectively control weeds. The present invention can also be applied in the breeding of crops and the screening of plant cell culture. Background technique [0002] Glyphosate is a very important herbicide. It inhibits 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS), an important enzyme in the biosynthesis of aromatic amino acids in plants. Glyphosate is an extremely broad-spectrum herbicide that is equally lethal to crops. So in order to be able to selectively kill weeds while the crops are growing, the crops need to acquire glyphosate resistance. [0003] Glyphosate is also able to inhibit 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) in the biosynthesis of...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/31C07K14/195C12N15/63C12N15/82C12P21/02
Inventor 沈志成
Owner ZHEJIANG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products