Antiglyphosate gene and its use
A glyphosate-resistant, gene-resistant technology, applied in application, genetic engineering, plant genetic improvement, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0022] Embodiment 1, the screening of anti-glyphosate bacterial strain
[0023] Glyphosate-contaminated soil samples were cultured in M63 medium containing 50 mM glyphosate. Since M63 does not contain aromatic amino acids, the surviving and growing bacteria are resistant bacteria. The formula of the medium is as follows: (per liter of M63: 13.6g KH.sub.2PO.sub.4, 2g(NH.sub.4).sub.2SO.sub.4, 0.5mgFeSO.sub.4-7H.sub .2O, 2.4mg MgCl.sub.2, 10g glucose, 10mg Thiamine-HCl and 25mg L-Proline). One of the strains, named G3, was selected for its ability to grow in M63 medium containing 200 mM glyphosate.
Embodiment 2
[0024] Embodiment 2, the identification of resistant bacterial strain
[0025] Partial 16sRNA sequence was obtained by PCR. The primers for PCR are universal primers for 16s bacterial RNA. The PCR products were cloned into pMD18-T plasmid and sequenced. It was found that it was identical to Burkholderia caryophylli, Pseudomonas sp. 'FSL R1-057' (AF205137), bacteriumSV70AB2-1 (AY770429), Pseudomonas putida (AB 180734) (AM184283); sex. The strain is therefore a Pseudomonas sp G3.
Embodiment 3
[0026] The cloning of embodiment 3, EPSPS gene
[0027] According to the gene sequence data of Pseudomonas genome sequenced in the gene bank, a set of degenerate primers (PsR: 5'gacatsgcgatrcgrtgrtg; PsFa: 5'gasctgcgsgtcaaggarwsyga) were designed. The product obtained by PCR was cloned with pMD18-T and sequenced. It was found to be similar to EPSPSs whose genomes have been sequenced, such as Pseudomonas putida. Progress designed PCR primers to amplify the full-length EPSPS fragment (PsN: 5'tggcccgccgggcctatgtggacgctatgaac, PsC: 5'tgaccggtgcttgcgaactcacgact) based on the relevant genome sequencing results. The full fragment amplified by PCR was cloned into pMD18-T and sequenced by ABI 3700. The nucleotide sequence of this gene is SEQ ID NO: 1, named Gt-1.
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com