Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for predicting angiotonin II receptor agonist hypotensor function and use

An angiotensin and antagonist technology, which is applied in the field of predicting the action of angiotensin II receptor antagonist antihypertensive drugs, and can solve the problems of unseen atrial natriuretic peptide association research and unseen kit products, etc.

Inactive Publication Date: 2006-11-08
ANHUI PROV INST OF BIOLOGICAL MEDICINE +1
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, there is no correlation study between the atrial natriuretic peptide (ANP) gene and the antihypertensive effect of irbesartan, and there is no kit product for the pharmacogenomics research of irbesartan

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for predicting angiotonin II receptor agonist hypotensor function and use
  • Method for predicting angiotonin II receptor agonist hypotensor function and use

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0060] Example 1: Determination of the Val7Met polymorphism of the ANP gene and prediction of the antihypertensive effect of angiotensin II receptor 1 antagonist antihypertensive drug irbesartan

[0061] (1) Determination of the Val7Met polymorphic site genotype of the ANP gene:

[0062] (1) Extract the genomic DNA of the host cell:

[0063] (a) Add 30ml of erythrocyte lysate to the whole blood, shake slowly, and let stand at room temperature for 10 minutes. During this period, shake several times to completely lyse the erythrocytes;

[0064](b) Centrifuge at 4°C at 2000 rpm for 10 minutes, remove the supernatant, break up the precipitated leukocytes on a rotary shaker, add 40ul of protease and 50ul of RNase, shake well, add 15ml of leukocyte lysate, Mix well in a 37°C water bath for 20 minutes, take it out, and put it in cold water;

[0065] (c) Add 4ml of cold protein precipitation solution, mix well and place in -20°C refrigerator for 5 minutes, take it out and centrifuge...

Embodiment 2

[0096] Example 2: Determination of the Val7Met polymorphism of the ANP gene to predict the target organ impact of angiotensin II receptor 1 antagonist antihypertensive drug irbesartan

[0097] (1) Measure the Val7Met polymorphic site genotype of the ANP gene (same as Example 1)

[0098] (2) Predict the risk of microalbuminuria:

[0099] For patients with essential hypertension, the risk of microalbuminuria in genotype 7Val / Met heterozygous or 7Met / Met homozygous mutant individuals is significantly higher than that of genotype 7Val / Val homozygous wild-type individuals.

[0100] The above method was verified by research, and patients with essential hypertension were grouped; ANP genotypes were grouped (homozygous wild type group, heterozygous type group + homozygous mutant group), and proteinuria was observed. The results are as follows:

[0101] In patients with essential hypertension, the risk of microalbuminuria in individuals carrying the 7Met allele was significantly highe...

Embodiment 3

[0104] Embodiment 3: kit composition (PCR-RFLP method) and application

[0105] 1. Kit components include:

[0106] Solution A: PCR buffer (PCR buffer), the components are KCL, Tris-HCl and MgCl2;

[0107] Solution B: deoxymononucleotide triphosphate (dNTP);

[0108] Liquid C: primer (Primer), synthesized by an oligonucleotide synthesizer; the sequence of the primer in the kit is:

[0109] Upstream primer: 5'GCCTGTAAGTCCTAGCTACTCC3'

[0110] Downstream primer: 5'GAATATTTTTAATTTCCCAGTGC3'

[0111] Solution D: heat-resistant DNA polymerase (Taq); storage temperature is -20°C;

[0112] Solution E: restriction endonuclease HpaII; storage temperature is -20°C;

[0113] Solution F: restriction endonuclease buffer, the components are Tris-HCl, NaCl, MgCl2, dithiothreitol.

[0114] 2. The steps of using this kit to amplify functional polymorphic sites and their flanking sequences and detect the genotypes of polymorphic sites are as follows:

[0115] (1) Amplify the target gene ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention provides a kind of reagent kit including reagent for detecting the polymorphic site genotype of natriuretic peptide gene of nucleic acid template. By means of PCR-RFLP method or Taqman method, the detection is fast, safe, convenient, sensitive and reliable. The detection can predict the hypotensive effect of angiotonin II receptor 1 agonist hypotensor and predict the functional state of the target organ of the primary hypertension patient, so that the medicine may be selected based on the individual difference to raise clinical treating efficiency and safety and lower the toxic side effect risk and treating cost.

Description

technical field [0001] The invention relates to a method for predicting the action of angiotensin II receptor antagonist antihypertensive drugs and its application. By measuring the genotype of a specific site in a biological sample, the angiotensin II receptor 1 antagonist antihypertensive drugs are predicted drug effect. Background technique [0002] Hypertension is one of the most common chronic diseases and a major risk factor for stroke, coronary heart disease, diabetes, etc. Therefore, effective control of blood pressure has important clinical and public health significance. There are six types of drugs clinically used to treat hypertension, including: angiotensin II receptor (AT1-R) antagonists, β-blockers, angiotensin converting enzyme inhibitors (ACEI), calcium antagonists , α-adrenoceptor blockers and diuretics. But so far the control rate of hypertension is low, the data of our country and the United States show that the control rate is only 8.1% and 34% respect...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68
Inventor 张善春蒋善群王琳琳洪秀梅毛广运李志平刘学唐根富张岩邢厚恂戴成祥王滨燕徐希平
Owner ANHUI PROV INST OF BIOLOGICAL MEDICINE
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com