Beta-mannase gene and amino acid sequence of its coded product and preparation method
A technology of mannanase and enzyme gene is applied in the field of amino acid sequence and preparation of acid β-mannanase gene and its encoded product to achieve the effect of expanding gene resources
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0048] Example 1: Cloning of β-mannanase gene
[0049] The total RNA of highly active Armillariella tabescens induced by konjac powder was extracted, and the β-mannanase sequences of 4 species with close relatives to fungi were retrieved from the Genebank protein database. The species were: Agaricus bisporus ), Aspergillus fumigatus Af293 (Aspergillus fumigatus), Aspergillus aculeatus (Aspergillus aculeatus), Hypocrea jecorina or Trichodermareesei (Trichoderma reesei), after multiple sequence alignment software clustalx analysis, the conserved region between the sequences was obtained, and then input into the block make (Protein Classification and Homology Database) analyzes the conserved regions of amino acid sequences without gaps; finally, use the primer design software CodeHop (Consensus Degenerate Hybrid Oligonucleotide Primers) to design multiple pairs of degenerate primers for these conserved regions, and use one pair of degenerate primers Use primers (5'GGTCCGGTGCTAGGC...
Embodiment 2
[0050] Example 2: Construction of high-copy recombinant expression plasmid pPICZαA-M
[0051] Referring to the enzyme cutting site of the pPICZαA vector, remove the signal peptide sequence from the cDNA sequence of the β-mannanase gene, add EcoRI and KpnI enzyme cutting sites, and add CAC CACCAC CAC CAC CAC (6His) before the stop codon TAG For full-length PCR, the primers are (5'CCGGAATTCGCTGTTCCTGAGTGGGGCCAATG3'; 5'CGGGGTACCCTAGTGGTGGTGGTGGTGGTGCGCCCGCGCTTTCAATGTAAC3'), the amplification conditions are denatured at 94°C for 4min, the first cycle is 94°C for 45s, 70°C for 45s, 72°C for 3min, and the annealing temperature for each subsequent cycle Decrease 1°C, a total of 5 cycles. Then perform 25 cycles of 94°C for 45s, 65°C for 45s, 72°C for 3min, and finally 72°C for 5min to amplify a fragment with a size of about 1300bp. The sequencing results show that the fragment size obtained is 1308bp consistent with the spliced sequence.
Embodiment 3
[0052] Example 3: High expression of β-mannanase in Pichia pastoris GS115
[0053] The recombinant expression plasmid pPICZαA-M was single-digested with Sac I, electrotransformed into Pichia pastoris GS115, and the histidine-tagged β-mannanase was recombinantly expressed. All have growth on the plate containing the zeocin of 100ug / ml, 500ug / ml, 1000ug / ml respectively, pick single bacterium colony plate culture respectively, through 1% methanol induction, recombinant bacterium GS115-pPICZαA-M is in the konjac powder containing Obvious hydrolysis circles appeared on the plates, showing highly active β-mannanase. Recombinant bacteria GS115-pPICZαA-M grown on zeocin of 100ug / ml, 500ug / ml, and 1000ug / ml were respectively picked and cultured overnight in 25ml / 250ml of BMGY medium at 28-30°C and 220-270 rpm, and the OD value reached 2 ~6, then transfer to BMMY medium 200ml / 1000ml at 28~30℃, 220~270°C for 108 hours, sampling and testing every 12 hours, using GS115-pPICZαA as a contro...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com