Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Bacterial leaf spot resistance related gene of rice, protein and its uses

A blight resistance, rice technology, applied in genetic engineering, plant genetic improvement, application, etc., can solve problems such as unclear biological functions

Inactive Publication Date: 2004-11-17
ZHEJIANG UNIV
View PDF0 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although the number of alternative splicing events was found to be increasing, its biological function is still unclear (Simpson, G.G. and Filipowicz, W. Plant Mol. Biol. 32, 1996, 1-41; Brown, J.W.S. and Simpson, C.G. . Rev. Plant Physiol. Plant Mol. Biol. 49, 1998, 77-95)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Bacterial leaf spot resistance related gene of rice, protein and its uses
  • Bacterial leaf spot resistance related gene of rice, protein and its uses
  • Bacterial leaf spot resistance related gene of rice, protein and its uses

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0087] Example 1 Cloning of RIX-4 Gene

[0088] Extraction of rice total RNA by one-step guanidine isothiocyanate / phenol / chloroform method. Poly(A+) mRNA was isolated from total RNA species using the Quick mRNA Isolation Kit (Qiagene). 2 μg poly(A) mRNA was reverse transcribed to form cDNA. The cDNA fragment was directional inserted into the multiple cloning site of the pBS SK(+) vector (Clontech) with the Smart cDNA Cloning Kit (Clontech), and transformed into DH-5α competent cells to form a cDNA library. The sequences of the 5' and 3' ends of all clones were determined with Dye terminate cycle reaction sequencing kit (promega, U.S.A.) and Megabase1000 sequencer. Comparing the determined cDNA sequence with the Genbank database, it was found that the cDNA sequence of one of the clones was a new DNA. The insert cDNA fragment contained in this clone was determined bidirectionally by synthesizing a series of primers. The results showed that the full-length cDNA contained in t...

Embodiment 2

[0089] Example 2 Cloning of the RIX-4 gene encoding the RIX-4 polypeptide by RT-PCR

[0090] The calluses of rice resistant variety (IR26) and susceptible variety (King Kong 30) were treated with Xanthomonas oryzae pv.oryzae, and total RNA was extracted respectively (strictly according to Trizol  Kit instructions require operation) as the template for the reverse transcription reaction, perform the reverse transcription reaction to synthesize cDNA according to the following system:

[0091] The primers are:

[0092] Primer1: 5'-GGCCACGCGTCGACTACTTTTTTTTTTTTTTT-3'(3' (for reverse transcription));

[0093] Primer2: 5′GGCCACGCGTCGACTACGGGGGGGGGG 3′(5′ (for reverse transcription))

[0094] Primer3: 5′-GGCCACGCGTCGACTAC-3′(3′ (for amplification))

[0095] Primer4: 5′-GGCCACGCGTCGACTAC-3′(5′ (for amplification))

[0096] The process is 100ng / μl 3'5' 2.5μl, RNA 5μl (about 200ng), 5μl DEPC-H 2 After O mixing, bathe in water at 70°C for 5 min and ice bath for 5 min; add 6 μl of 5...

Embodiment 3

[0099] Example 3 Analysis of RIX-4 gene expression by Northern blotting

[0100] Total RNA was extracted by a one-step method (Anal. Biochem. 1987, 162. 156-159). The method includes acidic guanidinium isothiocyanate-phenol-chloroform extraction. That is, use 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0) to homogenate the tissue, add 1 times the volume of phenol and 1 / 5 volume of chloroform-isoamyl alcohol (49:1 ), mixed and centrifuged. The aqueous phase was aspirated, isopropanol (0.8 vol) was added and the mixture was centrifuged to obtain an RNA pellet, which was washed with 70% ethanol, dried and dissolved in water. 20 µg of RNA was electrophoresed on a 1.2% agarose gel containing 20 mM 3-(N-morpholino)propanesulfonic acid (pH 7.0)-5 mM sodium acetate-1 mM EDTA-2.2M formaldehyde. Then transfer to nitrocellulose membrane. with α- 32 P dATP prepared by random primer method 32 P-labeled DNA probes. The DNA probe used was the sequence of ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a Xanthomonas oryzea pv.oryzae resistance related gene of wild rice, protein and uses, the multiple transcription polynucleotide sequences produced by RIX-4 gene alternative splicing and the corresponding open reading frame sequences, wherein the sequences possesses polynucleotide sequences represented by SEQ No.1-10, these cDNA fragments are closely related to the Xanthomonas oryzea pv.oryzae. The invention also provides the polynucleotide recombinant vector containing RIX-4 encoding genes and the gene engineering host cell, the method for cloning the RIX-4 genes, and the chromosome orientation of the RIX-4 genes.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a rice bacterial blight resistance-related gene, protein and application thereof. Background technique [0002] During the transcription of eukaryotic structural genes, the intron and exon of the broken gene are always transcribed into a large pre-mRNA molecule at the same time, and then undergo different splicing methods to obtain different maturation mRNA molecules and are translated into different proteins. Existing studies have shown that it is a very common phenomenon to produce diverse functional proteins through the splicing of a single gene in almost all protozoan tissues (Lopes et al, Annu.Rev.Genet.1998, 32:279-305 ); This shows that among many genes, one gene can encode multiple proteins. The DSCAM gene of Drosophila (related to neural development) can produce 38016 different proteins (Douglas L.B. et al, Cell. 2000, 103:367-370). Differen...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/415C12N15/29C12N15/63C12Q1/68
Inventor 董海涛姜玉新
Owner ZHEJIANG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com