Biomolecule with therapeutic tumour action and its use
A technology of biomolecules and anti-tumor drugs, applied in the field of biomolecules, can solve the problems of poor stability and weak effect, and achieve the effects of good stability, high selectivity and easy preparation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0059] The preparation of embodiment 1 tumesurin
[0060] Oncosurin is a double-stranded RNA molecule:
[0061] AGCAAGCCGCAAAGCAUUGGAAU
[0062] AUUCCAAUGCUUUGCGGCUUGCU that is to say, it consists of single-stranded A: AGCAAGCCGCAAAGCAUUGGAAU and single-stranded B: AUUCCAAUGCUUUGCGGCUUGCU, so single-stranded A and single-stranded B must first be synthesized respectively. Now there are commercial companies on the market that can undertake this task. For example, the inventors entrusted Inritrogen Co. USA to synthesize the above-mentioned single-chain A and single-chain B, and provide respective freeze-dried products.
[0063] Then, the RNA molecular lyophilized products of single-strand A and single-strand B synthesized above were respectively dissolved in nuclease-free water, and the respective concentrations were 0.4ug / ul. Each equal amount of simple solution was taken, and 5 times the concentration of Annealing buffer (0.5mM potassium acetate, 150mM Hepes, 100mM ma...
Embodiment 2
[0064] Example 2 Detecting the inhibitory effect of Tumorin on the expression of telomerase gene
[0065] Step (1) with liposome co-transfection method, tumor abolishin and telomerase gene (illustration: because there is no commercially available anti-telomerase antibody with high affinity, it is used to detect tumor cells, such as in liver cancer cell HepG2 cells Telomerase protein expression, so the gene fused with the coding sequence of the telomerase gene and the myc sequence is used to introduce into the cell for expression, and the expression level of myc can be detected indirectly by using a commercially available anti-myc antibody to determine the expression of the telomerase gene) Import Into cultured tumor cells:
[0066]Use 0.7mg pcDNA3 / Hert-myc (on the eukaryotic expression vector pcDNA3, insert the sequence encoding telomerase and myc sequence) and 0.3ug (0.3ul) oncosurin, add 50ul of nuclease-free water to mix, Add 5 ul of lipid (LipofectAmine, GIBCO) and 45 ul ...
Embodiment 3
[0076] Example 3 Detecting the inhibitory effect of oncosurin on the growth of cultured human liver cancer cells (HepG2 cells)
[0077] step 1)
[0078] Tumor and telomerase gene were co-transfected with liposomes (Note: because there is no commercially available high-affinity anti-telomerase antibody for detecting tumor cells, such as telomerase protein in liver cancer cells HepG2 cells Therefore, the gene fused with the coding sequence of the telomerase gene and the myc sequence is introduced into the cell to express it, and the expression level of the myc can be detected with a commercially available anti-myc antibody to indirectly determine the expression of the telomerase gene) into the cultured tumor In the cell:
[0079] Use 0.7mg pcDNA3 / Hert-myc (on the eukaryotic expression vector pcDNA3, insert the sequence encoding telomerase and myc sequence) and 0.3ug (0.3ul) oncosurin, add 50ul of nuclease-free water to mix, Add 5 ul of lipid (LipofectAmine, GIBCO) and 45 ul of...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com