Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Serum-independent rhabdovirus-pollution-free sf9 cell strain, screening method and application

A rhabdovirus and screening method technology, applied in the field of cell screening, can solve problems such as concerns about the safety of biological preparations, and achieve the effect of ensuring safety

Pending Publication Date: 2022-07-29
成都纳微金生物技术有限公司
View PDF5 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the discovery of a new rhabdovirus (Sf-RV) in the Sf cell line raises concerns about the safety of biologics produced by the insect cell-baculovirus expression vector system

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Serum-independent rhabdovirus-pollution-free sf9 cell strain, screening method and application
  • Serum-independent rhabdovirus-pollution-free sf9 cell strain, screening method and application
  • Serum-independent rhabdovirus-pollution-free sf9 cell strain, screening method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] The present embodiment provides a serum-independent screening method for sf9 cell lines without rhabdovirus contamination, comprising the following steps:

[0030] 1sf9 cells revive and adjust state

[0031] 1.1 Take one commercial source of sf9 cells from the liquid nitrogen tank, quickly put them in a 37°C water bath and shake them to thaw quickly. Resuspend the rapidly thawed cells in serum-free insect cell medium, and then centrifuge at 100g for 5 minutes. The supernatant was removed and resuspended in 15 ml of insect cell culture medium, and then cultured in a 125 shake flask at a temperature of 27°C and 120 rpm.

[0032] 1.2 The cell density in step 1.1 was grown to 4 x 10 6 Cells / ml were passaged, and the cell density was adjusted to 1 × 10 in serum-free insect cell medium. 6 cells / ml, cultured at 120 rpm at 27°C.

[0033] 1.3 The cell density in step 1.2 was grown to 4 x 10 6 Cells / ml were passaged, and the cell density was adjusted to 1 × 10 in serum-free i...

experiment example 1

[0048] Nodavirus detection was performed on sf9 cells and the sf9-RF cell line screened by the steps of Example 1, and the cell suspensions of the 10th, 15th, and 20th generations were collected for about 48 hours, and the RNA extraction kit Whole genome RNA was extracted, cDNA was synthesized using RNA as template, cDNA was added to PCR master mix, and primers RV-FP / RV-RP were added for PCR amplification.

[0049] The primers used in this experiment are designed according to the RV sequence as follows:

[0050] Primer RV-FP: TGGCGAGGGACTGCTTACAGAAGG

[0051] Primer RV-RP: CACAGCCGGGGGTGCAATCA

[0052] Specific steps are as follows:

[0053] (1) RV virus genome extraction: collect the cell suspensions cultured at the 10th and 20th generations for about 48 hours, extract the whole genome according to the RNA extraction kit, and follow the instructions of the kit for specific steps;

[0054] (2) Reverse transcription: reverse transcription using a one-step synthesis kit. The...

experiment example 2

[0063] Proliferative properties of sf9-RF cells

[0064] Culture sf9-RF cells and sf9 cells separately at 1 × 10 6 Cells / ml cell density, 25ml of cell suspension was inoculated in a 125ml shake flask and cultured at 27°C at 120rpm, sampling every 24 hours to detect cell viability using a cell counter until cell death.

[0065] Result: from figure 2 It can be seen that the growth phase cycle of the two cell lines sf9-RF and sf9 is the same, the cell doubling time is between 24-36 hours, and the cell diameter is 16-19 μm; the highest cell density of sf9-RF and sf9 cells is no different.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Cell diameteraaaaaaaaaa
Login to View More

Abstract

The invention relates to cell screening, in order to solve rhabdovirus pollution in an sf9 cell strain, the invention provides a serum-independent rhabdovirus-pollution-free sf9 cell strain, the cell strain is named as an sf9-RF cell strain, and the biological preservation number of the cell strain is CGMCC No.45028. The invention also provides a method for preparing the sf9 cell strain. The invention further provides a screening method of the serum-free rhabdovirus-pollution-free sf9 cell strain, and screening is carried out under a serum-free condition. The invention also provides an application of the serum-independent rhabdovirus-pollution-free sf9 cell strain in foreign protein expression or AAV production based on a baculovirus expression system. According to the serum-free rhabdovirus-pollution-free sf9 cell strain disclosed by the invention, a serum-free insect cell culture medium is used in the whole cell culture and screening process, and any exogenous virus is not introduced, so that various indexes of the cell line meet the requirements of cell matrixes for production, and when the cell line is applied to an expression system of baculovirus, the cell line can be used for preparing the rhabdovirus-pollution-free sf9 cell strain. And the safety of biological products can be effectively ensured.

Description

technical field [0001] The invention relates to the technical field of cell screening, in particular to a serum-independent rhabdovirus-free sf9 cell line, a screening method and an application. Background technique [0002] In the 1960s, the Vaughn team isolated a cell line from the ovarian tissue of female Spodoptera frugiperda pupa, established an insect cell line, and then provided it to the NERC Invertebrate Virology Department of Oxford University, UK, and further in a medium containing bovine serum. After acclimation, the cell line IPLB-Sf-21-AE was obtained. Subsequently, it was supplied to Texas A&M University for research and cloned and applied to the protein expression system. [0003] The sf9 cell line was cloned from IPLB-Sf-21-AE by G.E.Smith and C.L.Cherry. The cell state is more stable, sensitive to baculovirus, and can be used for protein expression and virus amplification. However, Ma et al. found that all sf cell lines (including two commercial sf21 and ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N5/07C12Q1/70G01N33/569C12N15/866C07K14/01C12R1/93
CPCC12N5/0601C12Q1/701G01N33/56983C12N15/86C07K14/005C12N2710/14043G01N2333/145G01N2333/08C12N2750/10022G01N2333/01
Inventor 杜恩岐王浩刘世佳
Owner 成都纳微金生物技术有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com