Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of reagent for losing CTTNBP2NL function in preparation of medicine for treating diseases

A technology with missing functions and reagents, applied in skin diseases, bone diseases, drug combinations, etc., to reduce phosphorylation, relieve symptoms of rheumatoid arthritis, and treat rheumatoid arthritis

Active Publication Date: 2022-04-05
WEST CHINA HOSPITAL SICHUAN UNIV
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, it has not yet been seen that the reagent for CTTNBP2NL function loss of the present invention is used for the preparation of medicines for the treatment of diseases

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of reagent for losing CTTNBP2NL function in preparation of medicine for treating diseases
  • Application of reagent for losing CTTNBP2NL function in preparation of medicine for treating diseases
  • Application of reagent for losing CTTNBP2NL function in preparation of medicine for treating diseases

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0056] Example 1. Overexpression of CTTNBP2NL causes increased phosphorylation of CTTNBP2NL in tumor cells

[0057] 1. Experimental method

[0058] 1. Cell culture

[0059] HEK293T, HEK293, HELA and other cells were purchased from ATCC and cultured in DMEM high-glucose medium, adding 10% fetal bovine serum and 1% penicillin and streptomycin. Cells were cultured in a cell incubator at 37°C, CO 2 The concentration is 5%. When the cell growth density was close to 90%, the cells were passaged. Use the kit to identify mycoplasma once a month to ensure that the cells are free from mycoplasma infection. The preserved cells were cultured in 75cm disposable cell culture flasks, and the remaining cells were cultured in culture dishes of different specifications.

[0060] 2. Carrier construction

[0061] (1) Extraction of cellular RNA

[0062] Use a 10cm cell culture dish to culture HEK293 cells or HELA cells. When the cell density is close to 70%, take out the culture dish, disca...

Embodiment 2

[0127] Example 2. Knockout of CTTNBP2NL causes reduction of STAT3 phosphorylation in tumor cells

[0128] 1. Experimental method

[0129] Lenti-CRISPRV2-CTTNBP2NL-guide RNA vector construction

[0130] The lentiCRISPR v2 vector was used as the eukaryotic expression vector, and the vector was purchased from Addgene. Use BsmBI of NEB Company for single enzyme digestion, enzyme digestion system: 50 μl, buffer: NEB Buffer 3.1, reaction time: 1h. Glue was recovered using the Tiangen Gel Recovery Kit.

[0131] The insert fragment is obtained by annealing into a double strand after synthesizing a single strand by the company. The annealing system: 20 μl, is carried out on a PCR machine, and the annealing conditions are: 95°C, 5min, 4°C, 5min.

[0132] The ligation was performed using T4 ligase from Quanjin Company, and the insert fragment and the digested lentiCRISPR v2 vector were ligated at a molar ratio of 7:1. Ligation conditions: overnight ligation at 16°C, and the ligation p...

Embodiment 3

[0148] Example 3. Knocking out or knocking down the expression of CTTNBP2NL in tumor cells leads to decreased cell proliferation and increased apoptosis of tumor cells

[0149] 1. Experimental method

[0150] 1. Interfering with lentiviral vector construction

[0151] (1) Synthesis of DNA fragments, annealing conditions: add 10 μl of sense strand + 10 μl of antisense strand DNA to a PCR tube, mix well, and place in a PCR machine at 95°C for 5 minutes and 4°C for 5 minutes.

[0152] The DNA sequence is:

[0153] guide RNA: ACTTTCATTGAAGAACGCTA:

[0154] Upstream: CACCG ACTTTCATTGAAGAACGCTA (SEQ ID NO.8)

[0155] Downstream: AAACTAGCGTTTCTTCAATGAAAGTC (SEQ ID NO.9)

[0156] guide RNA: GCCGCTGCCTTTCTTCCTCA:

[0157] Upstream: CACCG GCCGCTGCCTTTCTTCCTCA (SEQ ID NO. 10)

[0158] Downstream: AAACTGAGGAAGAAAGGCAGCGGCC (SEQ ID NO. 11)

[0159] guide RNA: TGTCACCTACATGCTAGAGA:

[0160] Upstream: CACCG TGTCACCTACATGCTAGAGA (SEQ ID NO.12)

[0161] Downstream: AAACTCTCTAGCATGTAGG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an application of a reagent for losing CTTNBP2NL function in preparation of a medicine for treating diseases. Mainly provides an application of a reagent for losing CTTNBP2NL function in preparation of drugs for treating diseases caused by STAT3 protein phosphorylation. The reagent for deleting the CTTNBP2NL function is a reagent for inhibiting the expression of the CTTNBP2NL or a reagent for inhibiting the promotion of the phosphorylation activity of STAT3 protein in tumor cells by the CTTNBP2NL. Overexpression of CTTNBP2NL can cause the occurrence of diseases. The function of CTTNBP2NL is lost, so that phosphorylation of the STAT3 protein Y705 site in tumor cells can be effectively reduced, and tumor growth is inhibited; meanwhile, the function of CTTNBP2NL is lost, so that the generation of autoantibodies can be reduced, and systemic lupus erythematosus can be treated; the traditional Chinese medicine composition can also relieve the symptoms of rheumatic arthritis, inflammatory bowel disease, psoriasis and the like, and effectively treat rheumatic arthritis, inflammatory bowel disease, psoriasis and the like. Therefore, the CTTNBP2NL function-deficient reagent can be used for medicines for treating tumors, autoimmune diseases and neurological diseases, and has a good application prospect.

Description

technical field [0001] The invention relates to the use of a reagent for making CTTNBP2NL function deficient in the preparation of medicines for treating diseases. Background technique [0002] Phosphorylation and dephosphorylation at specific sites on the protein surface are important post-translational modifications of proteins. This biological process plays an important role in intracellular signal transduction and changes in the activity state of enzymes. The most important difference between phosphorylation and dephosphorylation is that during phosphorylation, phosphate groups are added to amino acids of proteins by protein kinases whereas dephosphorylation is when phosphate groups are removed from Protein surface removal. Phosphate is usually derived from ATP or ADP. This process is ubiquitous in many physiological processes in organisms, especially in regulating protein function, localization, conformation, interaction and clearance. Phosphorylation and dephosphor...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K45/00A61P35/00A61P35/02A61P37/02A61P19/02A61P29/00A61P1/00A61P17/06A61P25/28A61P25/16
CPCY02A50/30
Inventor 白秀峰陈艳琼傅新元
Owner WEST CHINA HOSPITAL SICHUAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products