Method for detecting bactrocera dorsalis based on visual LAMP (loop-mediated isothermal amplification) technology and application
A technology of Bactrocera dorsalis and reaction, applied in the field of detection of Bacteralis dorsalis based on visual LAMP technology, can solve the problems that Bacteralis dorsalis cannot be detected, and achieve the goal of avoiding aerosol pollution, simple result detection and high sensitivity Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0033] Example 1 Primer Design
[0034] Based on a 633bp fragment (SEQ ID NO: 1) on the Bacteralis dorsalis mitochondrial COI gene. The sequence is as follows:
[0035] SEQ ID NO: 1:
[0036]TGAGCAGGAATAGTAGGAACATCCCTTAGAATTTTAGTCCG AGCTGAACTCGGTCACCCAGGAGCTTTAATCGGTGACGATCAA ATTTATAATGTAATTGTAACAGCTCATGCTTTCGTAATAATTTTCT TTATAGTTATACCAATTATAATTGGTGGATTTGGAAATTGACTTGT TCCTTTAATATTAGGAGCTCCCGATATAGCATTTCCACGAATGAA TAATATAAGATTTTGATTATTACCTCCTTCCCTTACATTACTATTAG TAAGAAGTATAGTAGAAAACGGAGCTGGTACAGGTTGAACAGT TTACCCACCCCTATCATCTGTTATTGCACACGGAGGAGCTTCAG TTGACCTAGCTATTTTTTCACTTCACTTAGCGGGTATTTCCTCAA TTTTAGGAGCAGTAAATTTCATTACAACAGTAATTAATATACGAT CGACAGGAATCACCTTTGATCGAATACCTCTATTCGTTTGAGCA GTTGTATTAACAGCTTTATTACTTTTATTATCATTACCAGTTTTAG CGGGGGCTATTACTATACTACTAACAGACCGAAACTTAAATACTT CCTTTTTTGACCCTGCTGGAGGAGGAGATCCTATTCTTTACCAA CATTTATTT
[0037] 1426 sequences at the same position of 73 species of Bactrocera downloaded from NCBI database were compared. Record the variable sites with h...
Embodiment 2
[0048] The effectiveness detection of embodiment 2 primers
[0049] The LAMP reaction was carried out on the populations of Bacteralis dorsalis collected in multiple regions. Since there is a certain variation in the genetic information of B. dorsalis individuals from different regions, if the primers can be successfully amplified on the target individuals, it means that Primer works. The fruit fly caught by the trap monitoring and trapping was used as the detection object (Table 1). All tested insects were verified by adult morphological identification (identification verification after raising larvae to adults) and DNA barcode identification.
[0050] The LAMP reaction detection steps are as follows:
[0051] a) Take the whole body or part of the tissue sample of the insect to be tested, and use the DNeasy Blood & Tissue kit (QIAGEN) to extract genomic DNA by referring to the instructions of the kit.
[0052] b) Utilize two pairs of specific amplification primers: FIP / BIP...
Embodiment 3
[0065] Embodiment 3 specific detection
[0066] The specificity of the LAMP primers was verified by testing different species of fruit flies. Insects other than Bactrocera dorsalis are shown in Table 2. All samples have been sequenced and compared to ensure that the species identification is correct. Deionized water was used as a blank control instead of DNA template.
[0067] Table 2 Insects other than Bactrocera dorsalis
[0068]
[0069] Figure 4 One of the reaction results is selected for sampling for electrophoresis detection results, such as Figure 4 As shown, Bactrocera dorsalis was successfully amplified, while other fruit flies were not amplified, which was in line with expectations.
[0070] Figure 5 The results of fluorescent color development are as follows: from left to right, they are numbered 1-4 Bactrocera dorsalis 5-8 Bactrocera dorsalis 9-12 Bactrocera squash 13-15 blank control. From the results, the primers are highly specific.
[0071] Imag...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap