Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method and kit for detecting N'orthologous gene N 'alta in tobacco

A detection method and homologous gene technology, applied in biochemical equipment and methods, DNA/RNA fragments, recombinant DNA technology, etc., can solve problems such as interference and N’alata obstacles

Pending Publication Date: 2022-02-01
YUNNAN ACAD OF TOBACCO AGRI SCI
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] There are resistance differences between N'orthologous genes, but the sequence similarity is very high, and the sequence identity is often above 97%, which creates obstacles for the application of N'alata in tobacco breeding, especially in the identification of During the N'alata process, it is often disturbed by other N' orthologs

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method and kit for detecting N'orthologous gene N 'alta in tobacco
  • Method and kit for detecting N'orthologous gene N 'alta in tobacco
  • Method and kit for detecting N'orthologous gene N 'alta in tobacco

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] The present invention retrieves a series of reported N' orthologous gene sequences, and uses these sequences to compare with N'alata. Nl423372, Nm555536). According to the comparison results, three sites were found ( figure 1 ), at these three sites, the bases of N'alata and other N' orthologous genes are all different, and the primers are designed based on these three sites, so as to achieve N'alata and other N' The purpose of distinguishing the source gene. Accordingly, a series of primer pairs were designed, and one primer in each primer pair used three positions found by sequence alignment as the 3' end of the primer to specifically amplify the N'alata gene. The positions of sites 2 and 3 are relatively close, so the forward primer AlataF1:GTTTGAAGTTGAAGGTTTCCTCAAATTGA is designed with site 2 as the 3' end, and the reverse primer Alata R1 is designed with site 3 as the 3' end: GCTTGGCTGCTAAATGTTTTCAAATTG. These two primers make full use of The difference between ...

Embodiment 2

[0036] A primer for detecting the N' orthologous gene N'alata gene, which is designed to be specific to the N'alata gene without amplifying other N' orthologous genes, including:

[0037]Alata F1: GTTTGAAGTTGAAGGTTTCTCCTAAGATTGA

[0038] Alata R1: GCTTGGCTGCTAAATGTTTTCAAATTG

[0039] A kit for detecting the N' orthologous gene N'alata gene, including

[0040] (i) Plant DNA extraction reagents;

[0041] (ii) detection system PCR reaction solution;

[0042] (iii) Sequencing system reagents;

[0043] Among them, the tissue DNA extraction reagent can be purchased from commercial reagents such as Tiangen Plant DNA Extraction Kit. The detection system PCR amplification reaction solution includes: 2x Taq master mix (Jinshore Protein Technology Co., Ltd.); the concentration of the upstream and downstream primers Alata F1 / R primers for detecting the gene sequence of the N’alata gene is 10 μM.

[0044] Sequencing system reagents include: sequencing purification solution (ExoI: 0.6U...

Embodiment 3

[0046] (1) The operation process of the tobacco plant DNA extraction kit (Tiangen Biology):

[0047] Operation steps Please add absolute ethanol to the buffer solution LP3 and rinse solution PW before use, please refer to the label on the bottle for the added volume.

[0048] 1) Processing materials: Take 100 mg of fresh plant tissue or 20 mg of dry weight tissue, add liquid nitrogen and grind thoroughly. Add 400 ul buffer FGA and 6 μl RNaseA (10 mg / ml), vortex for 1 min, and place at room temperature for 10 min.

[0049] 2) Add 130 μl buffer LP2, mix well, and vortex for 1 min.

[0050] 3) Centrifuge at 12,000 rpm (~13,400×g) for 5 min, and transfer the supernatant to a new centrifuge tube.

[0051] 4) Add 1.5 times the volume of buffer solution LP3 (for example, 500 μl filtrate plus 750 μl buffer solution LP3) (please check whether absolute ethanol has been added before use), shake and mix well for 15 seconds immediately, flocculent precipitation may appear at this time ....

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method and a kit for detecting an N'orthologous gene N 'alta in tobacco. According to the detection method, a primer for detecting an N 'alta gene is included, and the base sequence of the primer is as follows: Alata F1: GTTTGAAGTTGAAGGTTCTCCTAAGATTGAAlata R1:GCTTGGCTGCTAAATGTTTTCAAATTG. The method has the beneficial effect that a stable amplification system is constructed. The amplification efficiency can be optimal by adjusting reaction conditions such as primer concentration, annealing temperature and the like. A reliable, simple and convenient detection method can be provided for effectively detecting the N '-alta gene transferred in target tobacco, whether the N'-alta gene exists or not can be judged by judging whether a strip is obtained through amplification or not in most cases, sequencing is not needed, and the method is suitable for large-scale screening and transferring in tobacco breeding to obtain a group with the N '-alta gene.

Description

technical field [0001] The invention belongs to the field of biotechnology, in particular to a method for detecting the N' orthologous gene N'alata in tobacco and the technical field of a kit thereof. Background technique [0002] Tobacco mosaic virus (TMV) has the characteristics of large accumulation in plants, transmission by friction, and stable virus particles, so that humans still cannot completely control its production in crops such as tobacco, cucumber, tomato, and pepper. hazards in. TMV is an important pathogen on tobacco in my country, and its annual loss ranks at the top of the list of top ten tobacco infectious diseases. TMV virus has strain differentiation, and there are strains such as TMV-Cg and TMV-U1, among which TMV-U1 strain is the main harmful strain on tobacco. Planting TMV-resistant varieties is the most fundamental and also the most economical and effective means of preventing and controlling TMV. [0003] The source of resistance against TMV-U1 s...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6895C12Q1/686C12N15/11
CPCC12Q1/6895C12Q1/686C12Q2600/13C12Q2565/125
Inventor 袁诚刘勇黄昌军于海芹曾建敏童志军肖炳光方敦煌
Owner YUNNAN ACAD OF TOBACCO AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com