Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Regulatory gene for improving utilization rate and tolerance of capric acid in streptomyces roseosporus and application of regulatory gene

A technology of Streptomyces roseospora and gene regulation, applied in the field of genetic engineering, can solve the problems of unreported CRP gene tolerance, different effects, etc., and achieve the effects of improving tolerance, improving utilization rate and having broad application prospects.

Pending Publication Date: 2021-11-30
ZHEJIANG UNIV OF TECH +1
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The CRP of daptomycin has 89.3% nucleotide identity and 94.2% amino acid sequence identity with CRP of Streptomyces coelicolor. Through phylogenetic tree analysis, CRP widely exists in Streptomyces and has a high Conservative, but the role in most Streptomyces is not the same, some regulate Streptomyces spore development, some only regulate secondary metabolites, but no CRP gene has been reported to improve the tolerance of Streptomyces roseospora to capric acid

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Regulatory gene for improving utilization rate and tolerance of capric acid in streptomyces roseosporus and application of regulatory gene
  • Regulatory gene for improving utilization rate and tolerance of capric acid in streptomyces roseosporus and application of regulatory gene
  • Regulatory gene for improving utilization rate and tolerance of capric acid in streptomyces roseosporus and application of regulatory gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Embodiment 1: Construction of the pSET152CRP comprising the recombinant plasmid of CRP gene:

[0041] Blast the nucleotide sequence of the homologous gene CRP reported in Streptomyces coelicolor with the genome sequence of Streptomyces roseospora from NCBI (website: www.ncbi.nlm.nih.gov), and obtain the The target gene CRP, its size is 672bp.

[0042] Primers were designed with primer 5.0 as follows:

[0043] CRPS: ATTTCTAGAAATACCTGACCGAGCACG;

[0044] CRPA: ATTGGATCCATCGCACTGTTTTACCGT.

[0045] The total DNA of Streptomyces roseospora was extracted, and the CRP gene was amplified to obtain the target gene fragment.

[0046] Use the SanPerp Column Plasmid DNA Mini-Extraction Kit to extract the pSET152 plasmid according to the kit instructions. The resulting plasmid DNA solution was stored at -20°C or used for subsequent experiments.

[0047] The pSET152 plasmid was treated with restriction endonucleases, DNA agarose gel electrophoresis was performed after digestion, ...

Embodiment 2

[0052] Example 2: Transfer of Recombinant Plasmids to Streptomyces roseospora by Intragenus Conjugation

[0053] Escherichia coli ET12567 containing the recombinant plasmid PSET152 CRP was conjugatively transferred to Streptomyces roseospora NO.CGMCC4.7231, and the zygote containing the PSET152 CRP plasmid was obtained by screening with apramycin and nalidixic acid. The vector of pSET152 empty plasmid was used as a control.

[0054] Method for indirect conjugative transfer of Escherichia coli and Streptomyces roseospora NO.CGMCC4.7231:

[0055] Inoculate ET12567 (PUZ8002 / PSET152) and ET12567 (PUZ8002 / PSET152CRP) into LB (containing kanamycin / chloramphenicol / ampicillin) medium and culture overnight at 37°C in a shaker at 220rpm. Transfer ET12567 (PUZ8002 / PSET152) and ET12567 (PUZ8002 / PSET152CRP) to fresh LB medium (containing kanamycin / chloramphenicol / ampicillin) at a ratio of 1:100, shake at 220 rpm at 37°C Cultivate in bed until OD600 reaches 0.3-0.4. Resuspend the cells t...

Embodiment 3

[0060] Embodiment 3: Recombinant bacteria fermentation process

[0061] After the constructed Streptomyces roseospora strain was cultured in R5 slant medium at 30°C for 5 days, it was transferred to a shaker flask containing 50ml of YEME liquid medium, and cultured at 30°C for 25 hours with shaking (220rpm / min). Feed capric acid as the fermentation precursor, cultivate until the end of fermentation, measure the fermentation unit by HPLC, and select high-yield strains. attached by the manual figure 1 Compared with the existing Streptomyces roseospore (starting bacteria), the high antibiotic yield Streptomyces roseospore produced in the present invention has a higher fermentation yield, that is, a better daptomycin yield, and the fermentation Yield increased by more than 200%.

[0062] TSB liquid medium formula:

[0063] Tryptone 17g, soybean peptone 3g, D-glucose 2.5g, sodium chloride 5g, dipotassium hydrogen phosphate 2.5g, add deionized water to 1000ml, sterilize at 121°C ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a regulatory gene for producing daptomycin by streptomyces roseosporus. The nucleotide sequence of the regulatory gene is shown as SEQ ID NO: 1, or the nucleotide sequence of the same protein as the nucleotide sequence shown as SEQ ID NO: 1. By using the global regulatory factor CRP, the problems of high workload and high blindness of traditional streptomyces breeding are solved, the daptomycin high-yield strain cultured by utilizing genetic engineering is obtained, and the application prospect is wide; and the method is used for transforming the starting strain streptomyces roseosporus, and it is accidentally found that the CRP gene can improve the utilization rate of the streptomyces roseosporus to the capric acid in the fermentation process and improve the tolerance of the streptomyces roseosporus to the capric acid.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to a regulatory gene for improving the utilization rate and tolerance of capric acid in Streptomyces roseospora, its application and a method for obtaining Streptomyces with high antibiotic yield. Background technique [0002] Daptomycin is a novel cyclolipopeptide antibiotic produced by Streptomyces roseosporus, which interacts with the cell membrane in a calcium ion-dependent manner and exerts bactericidal activity. In December 2010, the US FDA approved a new dosing regimen for Cubist Pharmaceutical Co., Ltd.'s daptomycin (daptomycin) injection, Cubicin, which is intravenously injected once a day for 2 minutes. Cubicin was first approved in the United States in 2003 for the treatment of complicated skin and skin tissue infections caused by certain Gram-positive bacteria, including methicillin-resistant Staphylococcus aureus, by intravenous infusion once a day for 30 mi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/195C12N15/31C12N15/76C12N1/21C07K7/08C12P21/04C12R1/465
CPCC07K14/195C12N15/76C07K7/08C12P21/02C07K7/50C12N15/74
Inventor 吴杰群吴金荣方丽纳张薇杨永梅范萍沈建宇徐金勇方一民夏迷妮储消和
Owner ZHEJIANG UNIV OF TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com