Supercharge Your Innovation With Domain-Expert AI Agents!

CDC20-based high-temperature-resistant cell obtaining method and obtained high-temperature-resistant cell

A 1.CDC20, high temperature resistant technology, applied in the field of biomedicine, can solve problems such as limitation, achieve the effect of solving the increase of regulation and good clinical application value

Pending Publication Date: 2021-11-09
INST OF ZOOLOGY CHINESE ACAD OF SCI
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The current resistance to high temperature is mainly to reduce the body surface temperature by various means, but due to the uncertainty of the external environment, these methods are often limited

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • CDC20-based high-temperature-resistant cell obtaining method and obtained high-temperature-resistant cell
  • CDC20-based high-temperature-resistant cell obtaining method and obtained high-temperature-resistant cell
  • CDC20-based high-temperature-resistant cell obtaining method and obtained high-temperature-resistant cell

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1、39

[0053] Example 1. Detection of cell phenotype after high temperature treatment of human mesenchymal stem cells at 39°C

[0054] 1.1 High temperature treatment at 39°C promotes the apoptosis of mesenchymal stem cells

[0055] Wild-type human mesenchymal stem cells (hMSCs) were transferred to gelatin-coated six-well plates at a density of 1E5. After the medium was changed the next day, the cells were divided into two groups and placed in incubators at 37°C and 39°C for 48 hours. Apoptosis detection was performed using an apoptosis detection kit.

[0056] In this experiment, the Annexin V-EGFP cell apoptosis detection kit from Weiglass Company was used.

[0057] This kit contains the following materials:

[0058] name quantity Storage Conditions Annexin V-EGFP 40 / 100μl 4℃ Propidium Iodide (PI) 10 / 25μl 4℃ 4x Annexin V Binding Bufer 5 / 15μl 4℃

[0059] The specific method for detecting apoptosis is as follows:

[0060] 1.1.1. Preparation...

Embodiment 2

[0087] Example 2, human mesenchymal stem cells knocked out of CDC20

[0088] The present application found that knocking down the CDC20 (cell division cycle 20) gene can simulate the cell phenotype of human mesenchymal stem cells, which is caused by high temperature treatment at 39°C, which promotes apoptosis and inhibits proliferation.

[0089] The experimental steps are as follows:

[0090] 2.1. Preparation of recombinant lentivirus for knocking down human CDC20 gene

[0091] 2.1.1. Screen the sgRNA sequence for knocking down the CDC20 gene from the GeCKOv2.0 (1000000048) plasmid library, as follows:

[0092] KO-sgCDC20-F: 5′-CACC GTTCCCTGCCAGACCGTATCC -3' (the underlined part is the same as the target sequence)

[0093] KO-sgCDC20-R: 5′-AAAC GGATACGGTCTGGCAGGGAAC -3' (the underlined part is the same as the target sequence)

[0094] The oligonucleotide sequence of the gRNA targeting the CDC20 gene was synthesized at GENEWIZ, Inc., and KO-sgCDC20-F was annealed with KO...

Embodiment 3

[0113] Example 3, human mesenchymal stem cells activated by CDC20 transcription

[0114] The present application found that using the CRISPR / dCas9 transcriptional activation system to activate the transcription of the CDC20 (cell division cycle 20) gene in hMSCs can resist the increased apoptosis and inhibition of proliferation of hMSCs caused by high temperature treatment at 39°C.

[0115] The experimental steps are as follows:

[0116] 3.1. Preparation of recombinant lentivirus that activates human CDC20 gene

[0117] 3.1.1 Screen the sgRNA sequence that activates the CDC20 gene from the sam-human plasmid library, as follows:

[0118] SAM-sgCDC20-F:5′-CACC GCAGTACTAGTCCTCTGGCGC -3' (the underlined part is the gene encoding the spacer of the sgRNA that recognizes the CDC20 gene)

[0119] SAM-sgCDC20-R: 5′-AAAC GCGCCAGAGGACTAGTACTGC -3' (the underlined part is the gene encoding the spacer of the sgRNA that recognizes the CDC20 gene)

[0120] The oligonucleotide sequence o...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses application of CDC20 or a substance for regulating and controlling CDC20 expression in regulating and controlling cell high-temperature tolerance or preparing a product for regulating and controlling cell high-temperature tolerance. The substance for regulating and controlling CDC20 expression can be a substance for improving or enhancing CDC20 expression (namely a substance for improving or enhancing CDC20 gene expression). The invention also provides a method for improving cell high-temperature tolerance and an obtained high-temperature-resistant human mesenchymal stem cell. The obtained cell can resist cell apoptosis acceleration and cell proliferation inhibition caused by high temperature, can solve the problem of effect reduction caused by regulation increase of body core temperature accompanying in mesenchymal stem cell application, and has good clinical application value.

Description

technical field [0001] The invention belongs to the field of biomedicine, and in particular relates to a CDC20-based method for obtaining high-temperature-resistant cells and the obtained high-temperature-resistant cells. Background technique [0002] Mesenchymal stem cells are a kind of pluripotent stem cells, capable of self-renewal to maintain the stem cell pool, and can also differentiate into cells with specific functions. Mesenchymal stem cells can differentiate into a wide range of tissue types, so they have high clinical application value. Mesenchymal stem cells are clinically used to solve a variety of blood system diseases, cardiovascular diseases, liver cirrhosis, nervous system diseases, partial meniscus resection of the knee joint, repair of autoimmune diseases, etc. Major breakthroughs have been made, saving the lives of more patients. Additionally, mesenchymal stem cells hold great promise for nervous system repair and more. [0003] CDC20 is one of the cell...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/867C12N5/10C12N7/01C12R1/93
CPCC12N15/86C12N5/0668C07K14/4738C12N7/00C12N2510/00C12N2740/15043C12N2740/15021C12N2800/107
Inventor 刘光慧曲静张维绮王思程方季乾昭宋默识
Owner INST OF ZOOLOGY CHINESE ACAD OF SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More