Drug for killing tumor cells with gene mutation as well as preparation method and application of drug
A tumor cell and drug technology, which is applied in the field of gene-killing tumor cell drug and its preparation, can solve the problem of low targeting of tumor gene therapy
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
preparation example Construction
[0046] A method for preparing a drug for killing gene mutation tumor cells, comprising the following steps:
[0047] S1: Design a pair of CRISPR / Cas9 D10A gRNA for gene editing system;
[0048] In one embodiment, a gRNA with a length of 20 bp is designed according to the DNA sequence of the S45P mutation region of the beta-Catenin gene. see figure 1 , both gRNAs cover the S45P mutation site. Primers were designed to amplify the gRNA with T7 promoter and the DNA fragment of the scaffold (Scaffold) sequence from the all-in-one CRISPR / Cas9 vector.
[0049] The primer sequences used for amplification are as follows:
[0050] Cat-gRNA-F:
[0051] 5'-GGCCAGTGAATTGTAATACGACTCACTATAGGGAGGCGGGCTCCTCCTCTGAGTGGTAAGTTTTTAGAGCTAGAAATAGCAAG-3',
[0052] Cat-gRNA-R:
[0053] 5'-GGCCAGTGAATTGTAATACGACTCACTATAGGGAGGCGG CAGAGGAGGAGCTGTGGTAG GTTTTAGAGCTAGAAATAGCAAG-3',
[0054] The reverse universal primer is: T7-gRNA-R:
[0055] 5'-AAAAAAAGCACCGACTCGGTGCCACTTTTTTC-3'.
[0056] Usin...
Embodiment
[0071] Four gRNAs were designed, and gRNAs were synthesized using an in vitro transcription system. NEB company Cas9 endonuclease was used for in vitro digestion experiment, and the template was the linearized mutant beta-Catenin plasmid pENTR1A-5UTR-Cat(S45P). The results of agarose gel electrophoresis showed that ( image 3 ), the four gRNAs can guide the Cas9 enzyme to cut the template, and obtain fragments with a size of about 3000bp and 2200bp, but the efficiencies are slightly different. A pair of highly efficient gRNAs located in lane 3 and lane 5 were selected for further study, see figure 1 .
[0072] For convenience of comparison, the applicant constructed the eukaryotic expression recombinant plasmid of wild type and mutant beta-Catenin ( Figure 4 A), pCMV-Cat(WT) and pCMV-Cat(S45P), respectively. In order to facilitate the design of the homology arm of the donor, a 669 bp 5'-UTR was inserted between the CMV promoter and the start codon ATG. In order to facili...
PUM
Property | Measurement | Unit |
---|---|---|
concentration | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap