Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for producing L-5-methyltetrahydrofolate by biological method

A technology of methyltetrahydrofolate and methylenetetrahydrofolate is applied in the field of producing L-5-methyltetrahydrofolate and producing L-5-MTHF by constructing Escherichia coli engineering bacteria biological method, which can solve the problem of yield Small size, low purity, environmental pollution and other problems, to achieve the effect of saving time, strong specificity and cost

Active Publication Date: 2021-09-17
SHANDONG UNIV
View PDF5 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, chemical synthesis requires a large amount of strong chemical reducing agent, which has certain risks, and the synthesized 5-MTHF is a racemic mixture, which requires chiral resolution to obtain biologically active L-5-MTHF
In addition, chemical synthesis of 5-MTHF has a small yield and low purity, which pollutes the environment and is not conducive to human health
[0004] After searching, it is related to the metabolic transformation of Escherichia coli, the construction of a new synthetic L-5-MTHF metabolic pathway in its cells, and the blocking of the catabolic pathway of L-5-MTHF, and further biosynthesis by optimizing fermentation conditions The method of L-5-MTHF has not been reported

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for producing L-5-methyltetrahydrofolate by biological method
  • Method for producing L-5-methyltetrahydrofolate by biological method
  • Method for producing L-5-methyltetrahydrofolate by biological method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Embodiment 1: the construction of the engineering bacterium that produces L-5-MTHF

[0042] Take Clostridium autoethanogenum and Methylobacterium extorquens AM1 cells, and extract their genomic DNA from the cells according to the method recommended by the bacterial genomic DNA extraction kit.

[0043] According to the dihydrofolate reductase gene (folA) sequence design shown in nucleotide sequence SEQ ID NO.3 in the known E.coli BL21 (DE3) genome primer folA_F: GGAATTCCATATGATCAGTCTGATTGCGGC and folA_R: CCGCTCGAGTTACCGCCGCTC, with E.coli The BL21(DE3) genome was used as a template to amplify the folA gene, and the PCR cycle parameters were 95°C for 5min; (95°C for 30s, 56°C for 30s, 72°C for 15s); 72°C for 10min, 30 cycles.

[0044] According to the methylenetetrahydrofolate reductase gene (metF) sequence design primer metF_F shown in nucleotide sequence SEQ ID NO.4 in the known E.coli BL21 (DE3) genome: CATGCCATGGGCATGAGCTTTTTTCACG and metF_R: CCCAAGCTTTTATAAACCAGGTCGA...

Embodiment 2

[0061] Example 2: Analysis of exogenous gene transcription level of engineering strains

[0062] BL21-WL and BL21(ΔmetH)-C1T engineering bacteria are cultivated to OD in the medium in embodiment 1 600nm When the value is 0.8, take 1ml of bacterial liquid as the sample before induction. Then add IPTG with a final concentration of 0.8mM to induce for 12h, take 1ml of bacterial solution, and dilute to OD with sterile normal saline 600nm The value is 0.8, which is used as the bacterial liquid after induction treatment. The collected cells were extracted with the Easypure RNA Kit, and then reverse-transcribed with the AccuRT Genomic DNA Removal kit and 5×All-In-OneMasterMix to generate cDNA (25°C 10min; 42°C 15min; 85°C 5min), and the cDNA was diluted to the same concentration as a template for qPCR analysis. qPCR with Top Green qPCR Supermix was used as the dye, and LightCycler 480 was used for the reaction.

[0063] Using the expression level of the 16s rRNA gene as an inte...

Embodiment 3

[0070] Embodiment 3: the yield calculation method and LC-MS analysis of L-5-MTHF in engineering bacteria

[0071] (1) The broken method of BL21-WL or BL21(ΔmetH)-C1T engineering bacterium cell of gaining in embodiment 1 is: the engineering bacterium cell that obtains after centrifugation is in the anaerobic box with ascorbic acid containing 0.1% and containing 0.1% mercapto Resuspend in 50 mM Tris-HCl (pH 7.2) in ethanol to the same volume, seal it in an anaerobic vial with a rubber stopper, and break the cells by boiling in a water bath at 100°C for 10 minutes to obtain a cell disruption solution containing L-5-MTHF. Immediately after that, the supernatant was collected by centrifugation at 15,000 rpm at 4°C for 15 min, and fresh mouse serum (100 μl·ml -1 ), reacted at 37°C for 3h, boiled for 5min to terminate the reaction, centrifuged to take the supernatant, filtered through a 0.22μm cellulose acetate filter membrane, and put the filtrate into a liquid phase vial.

[0072]...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for producing L-5-methyltetrahydrofolate (L-5-MTHF) by a biological method. The method comprises the following steps of knocking out a methionine synthetase gene (metH) in a catabolism pathway in escherichia coli, and introducing a new metabolic pathway for producing the L-5-MTHF to construct an engineering bacterium BL21-WL strain or BL21 (delta metH)-C1T strain for producing the L-5-MTHF. By optimizing fermentation conditions for producing the L-5-MTHF by the constructed engineering bacteria, the maximum dry cell weight yield of the engineering bacteria can reach 445.94 mu g.g <-1>, is increased by 99.71% compared with that before optimization and reaches 10.0 times of that of an original strain, and the maximum dry cell weight yield of the engineering bacteria can reach 1249.11 mu g after being converted into the yield of each liter of culture and is far greater than the yield (119.84 mu g.L <-1>) of the L-5-MTHF which takes E.coli as host bacteria in the current report. It is indicated that the method and the constructed engineering bacteria have great application value and market prospects.

Description

technical field [0001] The invention relates to a method for producing L-5-methyltetrahydrofolate (L-5-MTHF), in particular to a method for producing L-5-MTHF by constructing Escherichia coli engineering bacteria, belonging to the field of biotechnology . Background technique [0002] L-5-methyltetrahydrofolate (L-5-MTHF), is the biologically active form of vitamin B9, can be directly absorbed by the human body to participate in the methylation process and DNA synthesis in the body, and has certain therapeutic effects on many diseases , such as macrocytic anemia, neural tube defects, and cancer, play an important role in maintaining human health. As the only folic acid drug that can pass through the blood-brain barrier, L-5-MTHF can be used to prevent Alzheimer's disease. In addition, the mutation of the methylenetetrahydrofolate reductase gene in the human body will affect the L-5-MTHF in the body. The synthesis of -MTHF can also cause a series of diseases in the human bo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12P17/18C12N1/21C12N15/70C12R1/19
CPCC12N9/003C12N9/0026C12N9/93C12N9/78C12N9/0028C12N15/70C12P17/182C12Y105/01003C12Y105/0102C12Y105/07001C12Y603/04003C12Y305/04009C12Y105/01005C12Y105/01015Y02A50/30
Inventor 王书宁王煜博张萌梁继禹伊继洪许平
Owner SHANDONG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com