Oncolytic virus NDV-NRP1 and construction method and application thereof
A construction method and technology of Newcastle disease virus, applied in the direction of application, virus, virus/phage, etc., can solve problems such as lack
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0033] 1. Materials
[0034] 1.1 Gene sequence
[0035] In this experiment, cDNA infectious clones NDV-NRP1-scFv, NDV-GT and NDV-NRP1-scFv-GT (NRP1 -The P2A sequence is used as the Linker between the scFv gene and the α1,3GT gene), and the reverse genetic technology is used to rescue the recombinant virus. The plasmids (pcDNA3.1-GT, pcDNA3.1-NRP1-scFv-GT) and primers used in this experiment were synthesized and purified by Shanghai Sangon Bioengineering Co., Ltd. The gene sequence is as follows:
[0036] NRP1-scFv sequence (726bp) SEQ ID NO.1:
[0037]ATGGAGGTGCAGCTGTTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTTAGCAGTTATTATATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCAGCGATCTCTCCTGGTAGTAGTAATAAATATTACGCTGATTCTGTAAAAGGTCGGTTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCCGTGTATTACTGTGCGAGAAGGAAGTATATGTTCGACTACTGGGGCCAGGGTACACTGGTCACCGTGAGCTCAGGTGGAGGCGGTTCAGGCGGAGGTGGCTCTGGCGGTGGCGGAATCCAGTCTGTGCTGACTCAGCCACCCTCAGCGTCTG...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com