Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Oncolytic virus NDV-NRP1 and construction method and application thereof

A construction method and technology of Newcastle disease virus, applied in the direction of application, virus, virus/phage, etc., can solve problems such as lack

Pending Publication Date: 2021-09-14
GUANGXI MEDICAL UNIVERSITY
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to the deficiency of α-1,3 galactosyltransferase (α-1,3galactosyltransferase, α1,3GT), which is required for α-Gal synthesis, humans, apes and Old World monkeys do not express α-Gal, however, due to human serum There are a large number of anti-α-Gal natural antibodies (anti-Gal), accounting for about 1% of serum IgG, while human cells lack the α-Gal epitope

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Oncolytic virus NDV-NRP1 and construction method and application thereof
  • Oncolytic virus NDV-NRP1 and construction method and application thereof
  • Oncolytic virus NDV-NRP1 and construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] 1. Materials

[0034] 1.1 Gene sequence

[0035] In this experiment, cDNA infectious clones NDV-NRP1-scFv, NDV-GT and NDV-NRP1-scFv-GT (NRP1 -The P2A sequence is used as the Linker between the scFv gene and the α1,3GT gene), and the reverse genetic technology is used to rescue the recombinant virus. The plasmids (pcDNA3.1-GT, pcDNA3.1-NRP1-scFv-GT) and primers used in this experiment were synthesized and purified by Shanghai Sangon Bioengineering Co., Ltd. The gene sequence is as follows:

[0036] NRP1-scFv sequence (726bp) SEQ ID NO.1:

[0037]ATGGAGGTGCAGCTGTTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTTAGCAGTTATTATATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCAGCGATCTCTCCTGGTAGTAGTAATAAATATTACGCTGATTCTGTAAAAGGTCGGTTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCCGTGTATTACTGTGCGAGAAGGAAGTATATGTTCGACTACTGGGGCCAGGGTACACTGGTCACCGTGAGCTCAGGTGGAGGCGGTTCAGGCGGAGGTGGCTCTGGCGGTGGCGGAATCCAGTCTGTGCTGACTCAGCCACCCTCAGCGTCTG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an oncolytic virus NDV-NRP1 and a construction method and application thereof, and belongs to the technical field of microorganisms. A recombinant virus NDV-NRP1-scFv-GT is constructed by adopting a reverse genetic technology, specific replication of rNDV in tumor cells is achieved at the transcriptional level by using an hTERT promoter, by combining NRP1-scFv with NRP1, invasion and growth of tumors are inhibited, and alpha-Gal epitope is overexpressed, so that anti-Gal of a human body can be induced to specifically target the tumor cells, complement is activated, killing of the tumor cells is achieved, and an effective anti-tumor effect is achieved.

Description

technical field [0001] The invention belongs to the technical field of microorganisms, and in particular relates to an oncolytic virus NDV-NRP1 and its construction method and application. Background technique [0002] Oncolytic virus, as a new tumor treatment agent, triggers anti-tumor immune response through two mechanisms: the killing effect of virus on tumor cells and the induction of systemic anti-tumor immune response. Oncolytic virotherapy combined with immune activation has emerged as an attractive modality for tumor therapy, as well as for orthotopic tumor vaccines. Moreover, oncolytic viruses can be constructed into agents that are tumor-specific, can enhance immune activation pathways, or can be used in combination with other tumor therapeutic drugs. In 1971, the Hungarian doctor Csatary discovered that farmers suffering from gastric cancer were cured after being infected with Newcastle disease virus (NDV), and thus discovered that NDV has the effect of treating ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N7/01C12N15/13C12N15/85C12N15/66C12N5/10A61K35/768A61P35/00
CPCC12N7/00C07K16/18C12N5/0686A61K35/768A61P35/00C12N2760/18121C07K2317/622C12N2760/18151
Inventor 赵永祥钟莉娉黄勇
Owner GUANGXI MEDICAL UNIVERSITY
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More