Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Gene of novel coronavirus B.1.351 South African mutant strain RBD and application of gene

A technology for coronaviruses and mutant strains, applied in applications, viruses, and viral peptides, can solve the problems of "antibody neutralization escape, vaccine failure, and increased difficulty in antibody recognition of viruses"

Active Publication Date: 2021-06-18
BIO-BANK CORP
View PDF2 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

If these sites mutate, it will increase the difficulty for the antibody to recognize the virus, so that the virus can escape "hunting"; mutations in the Spike region can easily lead to the phenomenon of "antibody neutralization and escape". Simply put, these mutations in the South African strain Traits that could make it more contagious and spread more easily could make it easier to evade antibodies, potentially rendering the vaccine ineffective

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene of novel coronavirus B.1.351 South African mutant strain RBD and application of gene
  • Gene of novel coronavirus B.1.351 South African mutant strain RBD and application of gene
  • Gene of novel coronavirus B.1.351 South African mutant strain RBD and application of gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0047] Example 1 Optimize wild new coronary virus B.1.351 South African mutant RBD sequence

[0048] Based on the amino acid sequence of wild-type new coronavirus RBD, the initial optimized new coronary virus B.1.351 South African mutant RBD nucleotide sequence:

[0049] The present invention optimizes the codon encoding an amino acid sequence in the coding sequence in accordance with the Chinese hamster genetic codener, and 3 candidate optimization sequences are obtained.

[0050] According to the preference of the codon, the laboratory has highly efficient expression experience, mRNA secondary structures, etc., optimized to obtain SEQIDNO.1:

[0051] AGAGTGCAGCCAACAGAGAGCATCGTGAGGTTCCCCAACATCACCAACCTGTGCCCCTTCGGCGAGGTGTTCAACGCAACAAGGTTCGCCAGCGTGTACGCCTGGAACAGAAAAAGGATCAGCAACTGCGTGGCAGACTACAGTGTGCTGTACAACTCCGCCTCCTTCTCCACCTTCAAATGCTATGGCGTGTCCCCCACCAAGCTGAACGATCTGTGTTTTACCAACGTGTACGCCGACTCCTTCGTGATTAGGGGCGACGAGGTGCGCCAGATCGCTCCTGGACAGACAGGAAACATCGCCGACTATAACTACAAGCTGCCCGACGACTTCA...

Embodiment 2

[0068] Example 2 Expression and purification of recombinant RBD proteins

[0069] The complete target gene shown in SEQIDNO is performed NHEL / NOTL double enzyme digestion, and then connected to a PCDNA3.1 + eukaryotic expression vector subjected to the same enzyme to obtain a recombinant carrier;

[0070] The recombinant vectors were converted into E. coli, and the plasmid was incremented by conventional methods, and plasmid was extracted with the Tinan Bio Co., Ltd. kit.

[0071]Transfection China Hamster CHO Cells: According to the Lipofectin Reagent Box Manual, the DNA-liposome mixture was obtained, and the DMEM medium was added to China hamster CHO cells, incubated at 37 ° C for 2 h; change in liquid into DMEM containing 10% FBS The medium was previously cultured for 48 h.

[0072] NEOMYCIN Resistance Cloning Screening: Separating the transfected cells from the culture bottle, plus 1 × 105 cells / holes to 96-well plates to continue culturing the DMEM medium containing 500 μ...

Embodiment 3

[0089] Example 3 Mouse immunoassay

[0090] Take 20 6 to 8 weeks old female BALB / C mice, randomly divided into the following groups:

[0091] Immunization 1 group (10 μg of immunization group): 100 μl of vaccine was injected at the end of 0 or 14th. The vaccine used is 10 μgRBDV2 + 100μg (OH) 3 Among them, RBDV2 is a novel coronavirus B.1.351 South African mutant RBD glycoprotein, which is prepared by Embodiment 2, is prepared by Embodiment 2, and contains 10 μg RBD and 100 μg (OH) according to 100 μl volume. 3 Use a physiological saline to compatibility with vaccine.

[0092] Immunization 2 groups (5 μg immunization group): 100 μl of vaccines were injected separately from 0 or 14th. The vaccine used is 5 μgrbdv2 + 100 μgal (OH) 3 Among them, RBDV2 is a new coronavirus B.1.351 South African mutant RBD glycoprotein, which is prepared by Embodiment 2, is prepared by Embodiment 2, containing 5 μg RBDV2 and 100 μg (OH) according to 100 μl volume. 3 Use a physiological saline to comp...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention belongs to the technical field of biology, and particularly relates to a gene of a novel coronavirus B.1.351 South African mutant strain RBD and application of the gene. The nucleotide sequence of the gene of the novel coronavirus B.1.351 South African mutant strain RBD provided by the invention is shown as SEQ ID NO.1 or SEQ ID NO.6. The gene sequence of the wild type novel coronavirus South African B.1.351 South African mutant strain RBD is optimized, a relatively optimal sequence is determined by combining with screening, and the cloning expression efficiency generated by the optimized sequence is greatly improved as compared with the expression efficiency of the wild type novel coronavirus B.1.351 South African mutant strain RBD sequence, so that the gene of the novel coronavirus B.1.351 South African mutant strain RBD can be used for preparing a novel coronavirus vaccine.

Description

Technical field [0001] The present invention belongs to the field of biotechnology, and is specifically involved in the gene and its application of Novel coronavirus B.1.351 South African mutant strain RBD. Background technique [0002] 2019 new coronavirus SARS-COV-2, the new coronavirus pneumonia COVID-19 is the 7th of the 7th type of coronavirus that can infect people, and the remaining six are HCOV-229E, HCOV-OC43, HCOV-NL63 , HCOV-HKU1, SARS-COV (induced severe acute respiratory syndrome) and MERS-COV (induced by the Middle East Respiratory Syndrome). [0003] The coronavirus is a type of RNA virus having a pyringe, a genome, which is a wide range of viruses existing in nature. The coronavirus particles are irregularly shaped, about 60-220 nm in diameter; the genome is about 27-32 kB, which is currently known to the genomic virus in the RNA virus. The virus particles are enzymes with a fat film, and there are three glycoproteins on the membrane: the thorn glycoprotein (S, Sp...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/50C12N15/85C07K14/165A61K39/215A61P31/14
CPCA61K39/12A61P31/14C07K14/005C12N15/85C12N2770/20022C12N2770/20034C12N2800/22
Inventor 翟俊辉杜红王轲珑
Owner BIO-BANK CORP
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com