Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Novel coronavirus b. 1.1.7 The gene of British mutant rbd and its application

A coronavirus and mutant technology, applied in the direction of viruses, applications, viral peptides, etc., can solve problems such as affecting vaccine effects and immune escape

Active Publication Date: 2021-09-07
BIO-BANK CORP
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The accumulation of such multiple mutations may cause "quantitative changes leading to qualitative changes", resulting in immune escape, which may affect the effect of vaccines

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Novel coronavirus b.  1.1.7 The gene of British mutant rbd and its application
  • Novel coronavirus b.  1.1.7 The gene of British mutant rbd and its application
  • Novel coronavirus b.  1.1.7 The gene of British mutant rbd and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] Example 1 Optimizing wild-type novel coronavirus B. 1.1.7 RBD sequence of British mutant strain

[0050] On the basis of the wild-type novel coronavirus RBD amino acid sequence, the following optimization was performed to obtain a preliminary optimized novel coronavirus B. 1.1.7 Nucleotide sequence of RBD of British mutant strain:

[0051] According to the bias of Chinese hamster genetic codons, the present invention optimizes the codons encoding the amino acid sequence in the coding sequence, and obtains 3 candidate optimized sequences in total.

[0052] According to the codon preference, the laboratory's previous high-efficiency protein expression experience, mRNA secondary structure and other factors, the optimized SEQ ID NO.1 was obtained:

[0053]AGAGTGCAGCCAACAGAGAGCATCGTGAGGTTCCCCAACATCACCAACCTGTGCCCCTTCGGCGAGGTGTTCAACGCAACAAGGTTCGCCAGCGTGTACGCCTGGAACAGAAAAAGGATCAGCAACTGCGTGGCAGACTACAGTGTGCTGTACAACTCCGCCTCCTTCTCCACCTTCAAATGCTATGGCGTGTCCCCCACCAAGCTGAACGATCTGTGTT...

Embodiment 2

[0069] Expression and purification of embodiment 2 recombinant RBD protein

[0070] The complete target gene shown in SEQ ID NO.6 (its electrophoresis result is as follows figure 1 shown), the gene was subjected to Nhel / Notl double digestion, and then connected to the pcDNA3.1+ eukaryotic expression vector that had undergone the same digestion to obtain a recombinant vector;

[0071] The recombinant vectors were transformed into Escherichia coli respectively, and the plasmids were amplified according to conventional methods, and then the plasmids were extracted with a kit from Tiangen Biological Co., Ltd.

[0072] Transfect Chinese hamster CHO cells: prepare according to the Lipofectin kit manual to obtain a DNA-liposome mixture, add it to Chinese hamster CHO cells cultured in DMEM medium, and incubate at 37°C for 2 hours; replace the medium with DMEM containing 10% FBS Medium, continue to culture for 48h.

[0073] Screening of Neomycin-resistant clones: Separate the transf...

Embodiment 3

[0087] Embodiment 3 mouse immunization experiment

[0088] Twenty 6- to 8-week-old female BALB / c mice were randomly divided into the following groups:

[0089] Immunization group 1 (10 μg immunization group): 100 μL vaccine was injected intramuscularly on days 0 and 14 respectively. The vaccine used is 10 μg RBD+100 μg Al(OH) 3 , wherein, RBD is the new coronavirus expressed by the CHO cells prepared in Example 2. British B. 1.1.7 Mutant RBD glycoprotein. Contains 10 μg RBD and 100 μg Al(OH) in a 100 μL volume 3 Compatible vaccines with saline.

[0090] Immunization group 2 (5 μg immunization group): 100 μL vaccine was injected intramuscularly on days 0 and 14 respectively. The vaccine used was 5 μg RBD+100 μg Al(OH) 3 , wherein, wherein, RBD is the new coronavirus expressed by the CHO cells prepared in Example 2. British B. 1.1.7 Mutant RBD glycoprotein, containing 5 μg RBD and 100 μg Al(OH) in 100 μL volume 3 Compatible vaccines with saline.

[0091] Adjuvant contro...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

The invention belongs to the field of biotechnology, in particular to novel coronavirus B. 1.1.7 The gene and application of the British mutant strain RBD. The novel coronavirus B of the present invention. 1.1.7 The nucleotide sequence of the RBD gene of the British mutant strain is shown in SEQ ID NO.1 or SEQ ID NO.6. The present invention optimizes wild-type novel coronavirus B. 1.1.7 The gene sequence of the British mutant strain RBD, combined with screening to determine the relative optimal sequence, the clone expression efficiency of the optimized sequence is higher than that of the wild type new coronavirus B. 1.1.7 The expression efficiency of the RBD sequence of the British mutant strain is greatly improved, thus, the novel coronavirus B of the present invention. 1.1.7 The RBD gene of the British mutant strain is more conducive to the preparation of new coronavirus vaccines.

Description

technical field [0001] The invention belongs to the field of biotechnology, in particular to novel coronavirus B. 1.1.7 The gene and application of the British mutant strain RBD. Background technique [0002] The 2019 novel coronavirus SARS-CoV-2, which causes novel coronavirus pneumonia COVID-19, is currently the seventh known coronavirus that can infect humans, and the remaining six are HCoV-229E, HCoV-OC43, and HCoV-NL63 , HCoV-HKU1, SARS-CoV causing severe acute respiratory syndrome and MERS-CoV causing Middle East respiratory syndrome. [0003] Coronaviruses are a class of RNA viruses with an envelope and a linear single-stranded positive strand genome. They are a large class of viruses that exist widely in nature. Coronavirus particles are irregular in shape, enveloped, round or oval in shape, with a diameter of about 60-220nm; the total length of the genome is about 27-32kb, and it is the virus with the largest genome among known RNA viruses. There are three kinds ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/50C12N15/85C12N5/10C07K14/165A61K39/215A61P31/14
CPCA61K39/12A61P31/14C07K14/005C12N15/85C12N2770/20022C12N2770/20034
Inventor 翟俊辉杜红王轲珑
Owner BIO-BANK CORP
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More