Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

The rbd gene of the new coronavirus b.1.351 South African mutant strain and its application

A coronavirus and mutant technology, applied in the direction of viruses, applications, viral peptides, etc., can solve problems such as increasing the difficulty of antibody recognition of viruses, vaccine failure, "antibody neutralization and escape"

Active Publication Date: 2021-08-13
BIO-BANK CORP
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

If these sites mutate, it will increase the difficulty for the antibody to recognize the virus, so that the virus can escape "hunting"; mutations in the Spike region can easily lead to the phenomenon of "antibody neutralization and escape". Simply put, these mutations in the South African strain Traits that could make it more contagious and spread more easily could make it easier to evade antibodies, potentially rendering the vaccine ineffective

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • The rbd gene of the new coronavirus b.1.351 South African mutant strain and its application
  • The rbd gene of the new coronavirus b.1.351 South African mutant strain and its application
  • The rbd gene of the new coronavirus b.1.351 South African mutant strain and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0047] Example 1 Optimizing the RBD sequence of the wild-type novel coronavirus B.1.351 South African mutant strain

[0048] On the basis of the wild-type novel coronavirus RBD amino acid sequence, the following optimization was performed to obtain the initially optimized RBD nucleotide sequence of the novel coronavirus B.1.351 South African mutant strain:

[0049] According to the bias of Chinese hamster genetic codons, the present invention optimizes the codons encoding the amino acid sequence in the coding sequence, and obtains 3 candidate optimized sequences in total.

[0050] According to the codon preference, the laboratory's previous high-efficiency protein expression experience, mRNA secondary structure and other factors, the optimized SEQ ID NO.1 was obtained:

[0051] AGAGTGCAGCCAACAGAGAGCATCGTGAGGTTCCCCAACATCACCAACCTGTGCCCCTTCGGCGAGGTGTTCAACGCAACAAGGTTCGCCAGCGTGTACGCCTGGAACAGAAAAAGGATCAGCAACTGCGTGGCAGACTACAGTGTGCTGTACAACTCCGCCTCCTTCTCCACCTTCAAATGCTATGGCGTGTCCCCCACCA...

Embodiment 2

[0068] Expression and purification of embodiment 2 recombinant RBD protein

[0069] The complete target gene shown in SEQ ID NO.6 is subjected to Nhel / Notl double digestion, and then connected to the pcDNA3.1+ eukaryotic expression vector that has undergone the same digestion to obtain a recombinant vector;

[0070] The recombinant vectors were transformed into Escherichia coli respectively, and the plasmids were amplified according to conventional methods, and then the plasmids were extracted with a kit from Tiangen Biological Co., Ltd.

[0071]Transfect Chinese hamster CHO cells: prepare according to the Lipofectin kit manual to obtain a DNA-liposome mixture, add it to Chinese hamster CHO cells cultured in DMEM medium, and incubate at 37°C for 2 hours; replace the medium with DMEM containing 10% FBS Medium, continue to culture for 48h.

[0072] Screening of Neomycin-resistant clones: Separate the transfected cells from the culture flask, add 1×105 cells / well to a 96-well pl...

Embodiment 3

[0089] Embodiment 3 mouse immunization experiment

[0090] Twenty 6- to 8-week-old female BALB / c mice were randomly divided into the following groups:

[0091] Immunization group 1 (10 μg immunization group): 100 μL vaccine was injected intramuscularly on days 0 and 14 respectively. The vaccine used is 10 μg RBDV2+100 μg Al(OH) 3 , wherein, RBDV2 is the RBD glycoprotein of the new coronavirus B.1.351 South African mutant strain expressed by the CHO cells prepared in Example 2, containing 10 μg RBD and 100 μg Al(OH) in a volume of 100 μL 3 Compatible vaccines with saline.

[0092] Immunization group 2 (5 μg immunization group): 100 μL vaccine was injected intramuscularly on days 0 and 14 respectively. The vaccine used is 5 μg RBDV2+100 μg Al(OH) 3 , wherein, RBDV2 is the RBD glycoprotein of the new coronavirus B.1.351 South African mutant strain expressed by the CHO cells prepared in Example 2, which contains 5 μg RBDV2 and 100 μg Al(OH) in a volume of 100 μL 3 Compatible ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

The invention belongs to the field of biotechnology, and in particular relates to the gene of the novel coronavirus B.1.351 South African mutant strain RBD and its application. The nucleotide sequence of the RBD gene of the novel coronavirus B.1.351 South African mutant strain of the present invention is shown in SEQ ID NO.1 or SEQ ID NO.6. The present invention optimizes the gene sequence of the wild-type novel coronavirus South Africa B.1.351 South Africa mutant strain RBD, and combines screening to determine the relative optimal sequence. The expression efficiency of the strain RBD sequence is greatly improved, so that the gene of the novel coronavirus B.1.351 South African mutant strain RBD of the present invention can be used to prepare novel coronavirus vaccines.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to the gene of the novel coronavirus B.1.351 South African mutant strain RBD and its application. Background technique [0002] The 2019 novel coronavirus SARS-CoV-2, which causes novel coronavirus pneumonia COVID-19, is currently the seventh known coronavirus that can infect humans, and the remaining six are HCoV-229E, HCoV-OC43, and HCoV-NL63 , HCoV-HKU1, SARS-CoV (causing Severe Acute Respiratory Syndrome) and MERS-CoV (causing Middle East Respiratory Syndrome). [0003] Coronaviruses are a class of RNA viruses with an envelope and a linear single-stranded positive strand genome. They are a large class of viruses that exist widely in nature. Coronavirus particles are irregular in shape, with a diameter of about 60-220nm; the genome is about 27-32kb in length, and it is the virus with the largest genome among known RNA viruses. Virus particles are covered with a fatty me...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/50C12N15/85C07K14/165A61K39/215A61P31/14
CPCA61K39/12A61P31/14C07K14/005C12N15/85C12N2770/20022C12N2770/20034C12N2800/22
Inventor 翟俊辉杜红王轲珑
Owner BIO-BANK CORP
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com