Freeze-drying protective agent of SNP detection reagent, and application
A technology of freeze-drying protective agent and detection reagent, which is applied in the biological field, can solve the problems of activity decline and loss, and achieve the effects of simple operation, reduced transportation cost, and avoiding repeated freezing and thawing
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] 1. Prepare the CYP3A5 genotyping detection reagent, the composition of which is shown in Table 2;
[0030] Table 2
[0031]
[0032]
[0033] 2. The 9 groups of protective agents (A-I) in Table 1 were prepared into a premix with the CYP3A5 genotyping detection reagent, and the CYP3A5 genotyping detection reagent without the protective agent was used as a control;
[0034] 3. The CYP3A5 upstream primer sequence is CGTATGTACCACCCAGCTTA, the CYP3A5 downstream primer sequence is GGTGTGACACACAGCAAGAG, the CYP3A5 wild-type probe is TCTTTCAGTATCTCTTC, and the CYP3A5 mutant probe sequence is TCTTTCAATATCTCTT;
[0035] 4. Fully mix and centrifuge the above-mentioned frozen premix;
[0036] 5. The above-mentioned freeze-preparation mixture is divided into PCR tubes with a volume of 19 μL, and placed in a freeze dryer (model: LGJ-15E);
[0037] 6. Set the freeze-drying program: the partition temperature drops to -50°C, pre-freeze for 4 hours; the first drying stage, the pa...
Embodiment 2
[0054] 1. Select the freeze-dried CYP3A5 typing detection reagent prepared by A protective agent, B protective agent, and C protective agent to conduct a thermal stability experiment, and conduct a preliminary evaluation of the stability of the reagent. At the same time, set up 2 groups of control groups, one of which is the control group One group was liquid CYP3A5 genotyping detection reagent (without protective agent), and the other control group was freeze-dried CYP3A5 genotyping detection reagent (without protective agent), which were placed in a biochemical incubator at 37°C for 7 days ;
[0055] 2. Conduct appearance inspection after acceleration (see image 3 and Figure 4 ), the test sample selection wild type sample (G / G), heterozygous sample (G / A), mutant sample (A / A), the amplification procedure is the same as Table 4;
[0056] 3. After the amplification, according to the amplification curve, select the appropriate fluorescence threshold (generally, the threshold...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap