Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Primers, kit and method for detecting TREX1 gene mutation

A technology of kits and sequencing primers, applied in biochemical equipment and methods, microbial determination/inspection, DNA/RNA fragments, etc. effect of difficulty

Pending Publication Date: 2021-03-26
济南艾迪康医学检验中心有限公司
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Li Huijuan’s research pointed out that the insertion mutation of the first exon c.460insA caused frameshift mutations in amino acids 154-156, and the stop codon TAG appeared in advance at position 156, which led to the truncation of TREX1 protein, truncated part of the The two Mg+ coordination domains and the transmembrane domain at the C-hydroxyl end of the catalysis affect the protein function
The study by Lee-Kirsch et al. showed that most of the children with lupus were detected as heterozygous mutations of TREX1 gene and located at the C' hydroxyl functional end, but the results of this study need to be confirmed by further experiments

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primers, kit and method for detecting TREX1 gene mutation
  • Primers, kit and method for detecting TREX1 gene mutation
  • Primers, kit and method for detecting TREX1 gene mutation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0052] Primers for detecting the mutation site of TREX1 gene, the primers are designed for the amplification primers designed for the whole exon of TREX1, including:

[0053] The primers for amplifying the whole exon sequence of TREX1 gene, its base sequence is:

[0054] TREX1-1F: TGTAAAACGACGGCCAGTGGGAACGGATGGTGGTGA

[0055] TREX1-1R: AACAGCTATGACCATGAGGGTGAGGTGGTTTCCTTAG

[0056] TREX1-2F1: TGTAAAACGACGGCCAGTTCGCAGACAGGGCAGGATTG

[0057] TREX1-2R1: AACAGCTATGACCATG CACTGGTGAGGCCCAGCATAG

[0058] TREX1-2F2: TGTAAAACGACGGCCAGTCCAACCTGCTCCTAGCCTTCC

[0059] TREX1-2R2: AACAGCTATGACCATGGACAAACACTGTGCCCTCCTC.

[0060] Kits for detecting TREX1 gene mutations, including:

[0061] (i) Blood DNA extraction reagents;

[0062] (ii) detection system PCR reaction solution;

[0063] (iii) Sequencing system reagents;

[0064] Among them, the tissue DNA extraction reagent can be purchased from commercial reagents such as Tiangen DNA extraction kit.

[0065] Detection system PCR ampl...

Embodiment 2

[0068] Operation process of blood / cell / tissue genomic DNA extraction kit (Tiangen Biology):

[0069] (1) Extract tissue DNA from blood:

[0070] 1) Take 300 μl of blood and add 900 μl of erythrocyte lysate, mix by inversion, and let stand at room temperature for 5 minutes, during which time, invert and mix several times. Centrifuge at 12000rpm for 1min, suck off the supernatant, leave the white blood cell pellet, add 200μl buffer GA, shake until thoroughly mixed;

[0071] 2) Add 20 μl proteinase K solution and mix well;

[0072] 3) Add 200 μl buffer GB, mix thoroughly by inversion, place at 70°C for 10 minutes, the solution should become clear, and briefly centrifuge to remove water droplets on the inner wall of the tube cap;

[0073] 4) Add 200 μl of absolute ethanol, shake and mix well for 15 seconds. At this time, flocculent sediment may appear, and briefly centrifuge to remove water droplets on the inner wall of the tube cap;

[0074] 5) Add the solution and flocculent ...

Embodiment 3

[0104] The clinical samples of 24 cases were extracted genomes, prepared reagents, amplified and sequenced according to the reagents and methods of Examples 1 and 2. Add 1 μl of sample to each detection system PCR reaction solution. figure 2 , 3 and 4 are the electrophoretic patterns of the amplified products obtained after the blood sample was amplified with TREX1-1F / 1R, TREX1-2F1 / 2R1, and TREX1-2F2 / 2R2 as primers, respectively. The lengths of fragments amplified by the present invention are 337bp, 587bp, and 768bp respectively, and the analysis of the electropherograms shows that the primers TREX1-1F / 1R, TREX1-2F1 / 2R1, and TREX1-2F2 / 2R2 of the present invention are effectively amplified, and the bands single.

[0105] The sequencing results of 24 samples showed that there were 5 mutation sites, and the mutation sites and their numbers are shown in the table below:

[0106]

[0107] Figure 5 The display is a screenshot of TREX1 exon 1 mutant sequencing, indicating that...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to primers and a method for detecting TREX1 gene mutation. The primers comprise primers for amplifying whole exon sequences of a TREX1 gene, and a Sanger sequencing technology and sequencing primers are adopted. According to the invention, the mutation of the whole exons of the TREX1 gene can be rapidly detected. The detection result obtained by the invention is accurate, theAicardi-Goutieres syndrome can be diagnosed in an auxiliary manner, and the primers and the method have important reference significance for diagnosis and prognosis of diseases.

Description

technical field [0001] The invention belongs to the field of molecular detection, in particular to a kit and a detection method for detecting TREX1 gene mutation. Background technique [0002] Aicardi-Goutieres Syndrome (AGS) is a group of rare genetic diseases mainly involving the nervous system and skin. Onset within 1 month, severe subacute encephalopathy manifested by seizures, chilblain-like rash on the skin, and aseptic fever, usually presenting with feeding difficulties, irritability, psychomotor regression, or developmental delay. Some patients showed hepatosplenomegaly and thrombocytopenia in the neonatal period. Symptoms take several months to develop before stabilizing. Although symptoms progress rapidly within the first year of life in most affected children, some also develop slowly, with predominant symptoms including dystonia, dyskinesia, or delayed cognitive development. [0003] Most of the disease is autosomal recessive inheritance, and a few are autosom...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6883C12Q1/6858C12N15/11
CPCC12Q1/6883C12Q1/6858C12Q2600/156C12Q2531/113C12Q2535/122
Inventor 刘赵玲王淑一
Owner 济南艾迪康医学检验中心有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com