Anti-IMP type carbapenemase hybridoma cell strain, monoclonal antibody and application
A technology of hybridoma cell line and carbapenemase, which is applied in the fields of application, anti-enzyme immunoglobulin, and resistance to vector-borne diseases, etc. It can solve the limitation of the range of clinical therapeutic drugs, the difficulty of clinical infection control and treatment, etc. problem, to achieve the effect of assisting clinical infection control and treatment
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0124] Example 1: Preparation of anti-IMP type carbapenemase antibody
[0125] 1.1 Antigen preparation
[0126] Obtain the IMP-4 type gene sequence from NCBI, carry out the whole gene synthesis and connect it to the pet-28a vector, transform the vector plasmid pet-28a-IMP-4 containing the target gene into the expression host Rosseta (DE3), and induce the conditions When the OD value of the bacterial solution is between 0.4 and 0.6, add IPTG to a final concentration of 1mM, incubate at 37°C for 3 hours, collect the bacterial cells by centrifugation, add about 1g of bacterial cells to 30mL PBS to resuspend the bacterial cells, and then ultrasonically break the cells with a power of 400 W, sonicate for 3 s, with an interval of 5 s. After about 30 minutes, the bacterial solution is not viscous and clarified. Centrifuge to remove the bacterial fragments, pass the supernatant through a 0.45 μm filter membrane, and load the sample until the filler is filled in advance and equilibrate...
Embodiment 2
[0135] Example 2: Identification of anti-IMP-type carbapenemase antibodies
[0136] 2.1 Antibody subclass identification
[0137] According to the instructions of the SIGMA kit, the subtype identification of monoclonal antibody was carried out by the method of capture ELISA, as follows:
[0138] After diluting the monoclonal antibody subtype identification reagent 1:1000, add it to the enzyme-labeled well, 100 μL / well, incubate at 37°C for 1 hour; wash with PBST three times, and pat dry; add the antibody after diluting 1:1000 times, 100 μL / well , incubated at 37°C for 1 hour; washed three times with PBST, and patted dry; HRP enzyme-labeled goat anti-mouse IgG secondary antibody was diluted at 1:6000 and added, 100 μL / well, incubated at room temperature for 30 minutes; color development for 10-20 minutes. The subtype of the monoclonal antibody belongs to the subtype whose OD450 reading value is significantly higher than that of the subtype reagent added to other wells. The an...
Embodiment 3
[0143] Example 3: Genetic validation of anti-IMP-type carbapenemase antibodies
[0144] Ig variable region genes were cloned by RT-PCR. Extract total RNA, synthesize single-stranded cDNA, extract total RNA from 1AA4 and AH9 hybridoma cell lines by Trizol method (kit purchased from Invitrogen), and reverse total RNA to cDNA with M-MLV reverse transcriptase (purchased from Invitrogen) library.
[0145] Heavy chain framework region upstream primer
[0146] P1: 5'SAGGTGMAGCTKCASSARTCWGG3'
[0147] Heavy chain variable region downstream primer
[0148] P2: 5'TGGGGSTGTYGTTTTGGCTGMRGAGACRGTGA3'
[0149] light chain leader peptide upstream primer
[0150] P3: 5'ATGGATTTTCAAGTGCAGATTTTCAG3'
[0151] Light chain variable region downstream primer
[0152] P4: 5'GGATACAGTTGGTGCAGCATCAGCCCGTTT3'
[0153] Prepare the PCR reaction system (50 μl) as follows:
[0154] cDNA: 2μl; Upstream primer (10μM): 2μl; Downstream primer (10μM): 2μl; dNTP mixture: 2μl; pfuDNA polymerase (5U / μl): 1...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com