Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

CRISPR Cas9 conditional gene knockout mouse and establishment method

A technology for gene knockout and method establishment, applied in the field of gene knockout, can solve problems such as poor gene knockout effect, and achieve the effect of improving gene knockout effect

Pending Publication Date: 2020-11-20
JIANGXI UNIVERSITY OF TRADITIONAL CHINESE MEDICINE
View PDF4 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, existing gene knockouts are poorly
[0003] Through the above analysis, the problems and defects of the existing technology are: the existing gene knockout effect is poor

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • CRISPR Cas9 conditional gene knockout mouse and establishment method
  • CRISPR Cas9 conditional gene knockout mouse and establishment method
  • CRISPR Cas9 conditional gene knockout mouse and establishment method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] 1. Method

[0036] The gRNA designed for the mouse Pkd1 gene, the donor vector carrying the loxP site, and the Cas9 mRNA were co-injected into the fertilized mouse eggs. The first F0 generation mice obtained need to be identified by PCR, sequenced and verified, and then bred with wild-type mice Subculture, and deliver F1 generation positive mice.

[0037] 2. gRNA primer sequence (SEQ ID NO: 1)

[0038] gRNA1 (reverse): ATGATGAACCTGGCAAGTCAGG

[0039] gRNA2 (forward): CCGTACATATTCGTTGTTAAGGG

[0040] 3. Breeding program, such as figure 2 shown.

[0041] 4. Identification scheme, such as image 3 shown.

[0042] 5. PCR screening, such as Figure 4 and Figure 5 Shown:

[0043] PCR primer 1 (annealing temperature 60.0°C): (SEQ ID NO: 2)

[0044] 5'arm forward primer (F1): 5'-AAGGTCCCCATTCGCTAAGACAAAC-3'

[0045] 3'loxP reverse primer (R1): 5'-GTGGAACAATGCCCAGTCTGA-3'

[0046] PCR primer 2 (annealing temperature 60.0°C): (SEQ ID NO: 3)

[0047] 5'loxP forward pr...

Embodiment 2

[0072] 1. Mouse Pkd1 conditional knockout project (CRISPR / Cas9)*-vC

[0073] 1.1 Purpose:

[0074] A Pkd1 conditional knockout mouse model (C57BL / 6N) was created by CRISPR / Cas-mediated genome engineering.

[0075] 1.2 Policy summary:

[0076] The Pkd1 gene (NCBI reference sequence: none; aggregate: ENSMUSG00000032855) is located on mouse chromosome 17.

[0077] 46 exons were identified, the ATG start codon of exon 1 and the TAG stop codon of exon 46 (caption: ENSMUST00000035565).

[0078] Select exon 2-8 as the conditional knockout region (cKO region). Deletion of this region should result in loss of function of the mouse Pkd1 gene.

[0079] To engineer the targeting vector, homology arms and cKO regions will be generated by PCR using BAC clone RP24-282C1 as template.

[0080] Cas9, gRNA and targeting vector will be co-injected into fertilized eggs to generate cKO mice.

[0081] Puppies will be genotyped by PCR and subsequent sequencing analysis.

[0082] NOTE: Homozygo...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of gene knockout, and discloses a CRISPR Cas9 conditional gene knockout mouse and an establishment method. According to the establishment method, a vectoris designed and constructed, and gRNA and Cas9 protein are prepared; a gRNA sequence and a targeting vector are designed; the targeting vector is constructed by the In-Fusion technology, and the targeting vector is verified by restriction digestion, PCR and sequencing; the gRNA and Cas9 protein are prepared at the same time; microinjection and F0 mouse identification are performed; the obtained Donor vector, gRNA and Cas9 protein are co-injected into a fertilized egg; the fertilized egg after microinjection is returned to the oviduct of a surrogate mouse; PCR and sequencing identification areperformed after a mouse is born, and a positive F0 mouse is obtained; the reproduction and identification of a F1 generation mouse are performed; the sexually mature positive F0 mice are matched withwild-type mice respectively for reproducing the first generation, and a polycystic kidney gene PKD1 knockout mouse is obtained successfully.

Description

technical field [0001] The invention belongs to the technical field of gene knockout, and in particular relates to a CRISPR Cas9 conditional gene knockout mouse and a method for establishing it. Background technique [0002] Gene knockout (knockout) is a kind of exogenous DNA introduction that uses a DNA fragment containing a certain known sequence to undergo homologous recombination with a gene with the same or similar sequence in the genome of the recipient cell, integrates into the genome of the recipient cell, and is expressed technology. It is aimed at a sequence whose sequence is known but whose function is unknown, changing the genetic gene of the organism, making the specific gene function ineffective, so that part of the function is blocked, and can further affect the organism, and then infer the gene's function biological functions. Gene knockout and gene insertion technologies are the latest exogenous DNA introduction technologies that emerged in the 1990s. Gen...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/85C12N15/89A01K67/027
CPCC12N15/8509C12N15/89A01K67/0276C12N2800/107A01K2217/075A01K2227/105A01K2267/03
Inventor 马广强牛玲韩飞艾志福黄小英杨明
Owner JIANGXI UNIVERSITY OF TRADITIONAL CHINESE MEDICINE
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com