CRISPR Cas9 conditional gene knockout mouse and establishment method
A technology for gene knockout and method establishment, applied in the field of gene knockout, can solve problems such as poor gene knockout effect, and achieve the effect of improving gene knockout effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] 1. Method
[0036] The gRNA designed for the mouse Pkd1 gene, the donor vector carrying the loxP site, and the Cas9 mRNA were co-injected into the fertilized mouse eggs. The first F0 generation mice obtained need to be identified by PCR, sequenced and verified, and then bred with wild-type mice Subculture, and deliver F1 generation positive mice.
[0037] 2. gRNA primer sequence (SEQ ID NO: 1)
[0038] gRNA1 (reverse): ATGATGAACCTGGCAAGTCAGG
[0039] gRNA2 (forward): CCGTACATATTCGTTGTTAAGGG
[0040] 3. Breeding program, such as figure 2 shown.
[0041] 4. Identification scheme, such as image 3 shown.
[0042] 5. PCR screening, such as Figure 4 and Figure 5 Shown:
[0043] PCR primer 1 (annealing temperature 60.0°C): (SEQ ID NO: 2)
[0044] 5'arm forward primer (F1): 5'-AAGGTCCCCATTCGCTAAGACAAAC-3'
[0045] 3'loxP reverse primer (R1): 5'-GTGGAACAATGCCCAGTCTGA-3'
[0046] PCR primer 2 (annealing temperature 60.0°C): (SEQ ID NO: 3)
[0047] 5'loxP forward pr...
Embodiment 2
[0072] 1. Mouse Pkd1 conditional knockout project (CRISPR / Cas9)*-vC
[0073] 1.1 Purpose:
[0074] A Pkd1 conditional knockout mouse model (C57BL / 6N) was created by CRISPR / Cas-mediated genome engineering.
[0075] 1.2 Policy summary:
[0076] The Pkd1 gene (NCBI reference sequence: none; aggregate: ENSMUSG00000032855) is located on mouse chromosome 17.
[0077] 46 exons were identified, the ATG start codon of exon 1 and the TAG stop codon of exon 46 (caption: ENSMUST00000035565).
[0078] Select exon 2-8 as the conditional knockout region (cKO region). Deletion of this region should result in loss of function of the mouse Pkd1 gene.
[0079] To engineer the targeting vector, homology arms and cKO regions will be generated by PCR using BAC clone RP24-282C1 as template.
[0080] Cas9, gRNA and targeting vector will be co-injected into fertilized eggs to generate cKO mice.
[0081] Puppies will be genotyped by PCR and subsequent sequencing analysis.
[0082] NOTE: Homozygo...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com