Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Survivin-whole-antigen-targeted DC cells, CTL cells, preparation method therefor and application of CTL cells

A whole antigen and cell technology, applied in the direction of genetically modified cells, botany equipment and methods, biochemical equipment and methods, etc., can solve the problems of high economic expenditure, no survivin expression, poor efficacy, etc., and achieve high-efficiency expression Effect

Inactive Publication Date: 2020-09-11
CELARTICS BIOPHARMA CO LTD
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Some scholars once transfected DC cells with adenovirus carrying the full-length sequence of survivin, but there is no prior art report on the expression of survivin in this technology
[0004] In view of the poor effectiveness of the above methods in practical application, high economic expenditure, time cost and uncertainty of results, it is necessary to develop new T cell therapy targeting Survivn targets with strong utility and low capital and time consumption

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Survivin-whole-antigen-targeted DC cells, CTL cells, preparation method therefor and application of CTL cells
  • Survivin-whole-antigen-targeted DC cells, CTL cells, preparation method therefor and application of CTL cells
  • Survivin-whole-antigen-targeted DC cells, CTL cells, preparation method therefor and application of CTL cells

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035]Example 1, DC cells and target cells loaded with Survivin antigen

[0036] In this example, DC cells and target cells loaded with Survivin whole antigen (amino acid sequence shown in SEQ ID No. 2) were prepared according to the following operations.

[0037] 1. Design primers, clone Survivin gene by PCR, and construct lentiviral vector

[0038] (1) According to the Survivin nucleic acid sequence (SEQ ID No. 1) published in NCBI nucleotide, in the present invention, primers were designed and synthesized by a third party. The designed primer sequences are shown in SEQ ID No. 3 and SEQ ID No. 4.

[0039] Survivin nucleic acid sequence (SEQ ID No. 1):

[0040] ATGGGTGCCCCGACGTTGCCCCCTGCCTGGCAGCCCTTTCTCAAGGACCACCGCATCTCTACATTCAAGAACTGGCCCTTCTTGGAGGGCTGCGCCTGCACCCCGGAGCGGATGGCCGAGGCTGGCTTCATCCACTGCCCCACTGAGAACGAGCCAGACTTGGCCCAGTGTTTCTTCTGCTTCAAGGAGCTGGAAGGCTGGGAGCCAGATGACGACCCCATAGAGGAACATAAAAAGCATTCGTCCGGTTGCGCTTTCCTTTCTGTCAAGAAGCAGTTTGAAGAATTAACCCTTGGTGAATTTTTGAAACTGGACAGA...

Embodiment 2

[0090] Example 2, DC-Survivin induces and expands immune cells

[0091] In this implementation, DC-Survivin is used to induce and expand immune cells, and the preparation process mainly includes:

[0092] (1) Take the antigen-loaded DC cells and autologous PBMC cells and count them.

[0093] (2) Use X-VIVO medium containing 5% human serum, mix DC cells and PBMC cells according to the amount of DC cells:PBMC=1:5~1:500, and culture overnight.

[0094] (3) The next day, add 200~1000unit / ml interleukin 2 to the culture system, mix and culture.

[0095] (4) Add appropriate amount of medium and interleukin 2 according to the growth status of the cells.

[0096] (5) On day 12-14, some cells were collected for flow cytometric analysis.

[0097] (6) Take 1-5×10 5 cells, centrifuged at 2500rpm for 5min.

[0098] (7) Wash twice with PBS, centrifuge at 2500rpm for 5min.

[0099] (8) Add 100 μl BSA-containing blocking solution to the cells, and block on ice for 10-15 minutes.

[010...

Embodiment 3

[0118] Example 3, the killing effect of Survivin antigen-specific CTL cells on target cells

[0119] In this example, the killing effect of Survivin antigen-specific CTL cells on target cells was investigated. Related methods include the following operations:

[0120] (1) Digest target cells 3T3L / Survivin, 3T3L / 2402 / Survivin, 3T3L / 224 / Survivin, count, inoculate 5x104 cells / well in a 24-well plate, and adhere to the wall for 2-3 hours;

[0121] (2) For cell counting, effector cells were added to target cells according to the effector cell:target cell ratio of 1:1, 2:1, 5:1 and 10:1 respectively, and mixed culture for 4 hours;

[0122] (3) Discard the suspended T cells, wash gently with PBS for 1-3 times to remove floating dead target cells, and blot the liquid in the well;

[0123] (4) Add 100 μl of cell lysate to each well and lyse on ice to release the luciferase protein from the cells;

[0124] (5) Transfer the lysate to a 1.5ml EP tube, centrifuge at 3000rpm for 3min;

...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides Survivin-whole-antigen-targeted DC cells, CTL cells, a preparation method therefor and application of the CTL cells. The invention firstly provides Survivin-whole-antigen-loadedDC cells. The DC cells presenting a whole antigen survivin are obtained through cloning a gene sequence encoding a survivin whole-protein antigen to a lentiviral vector so as to transfect amplifiabledendritic cells. A large number of high-activity CTL cells are further obtained through subjecting the Survivin-whole-antigen-loaded DC cells and autologous PBMC cells to mixed culture. Shown by killing experiments, these CTL cells can efficiently kill survivin-antigen-carrying target cells, and a killing effect of the CTL cells is positively correlated to a matched degree of HLA molecules.

Description

technical field [0001] The invention belongs to the technical field of cellular immunotherapy, and in particular relates to a DC cell and a CTL cell targeting the entire Survivin antigen and a preparation method and application thereof. Background technique [0002] Survivin is a member of the inhibitor of apoptosis protein (IAP) family and has dual functions of inhibiting apoptosis and regulating cell mitosis. It is an important molecule that regulates cell cycle and apoptosis. It is known that survivin protein is highly expressed in various tumor tissues. Studies have shown that the expression of survivin in malignant tumors of the urinary system (bladder cancer, prostate cancer, cervical cancer, and kidney cancer) is positively correlated with the degree of malignancy of the tumor. At the same time, the study found that the positive rate of Survivin expression in colorectal cancer tissues was significantly higher than that in adjacent normal tissues, and it was positivel...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N5/10C12N15/867C12N5/0783
CPCC07K14/4703C12N5/0638C12N5/0639C12N15/86C12N2510/00C12N2740/15043
Inventor 张欢程铧
Owner CELARTICS BIOPHARMA CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com