A kind of method of controlling aphids by combined application of aphid control agent, RNAi and Beauveria bassiana
A technology for Beauveria bassiana and aphids, which is applied in the fields of pest control and genetic engineering, can solve problems such as poor results, and achieve a wide range of applications
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030] Based on the transcriptome sequencing data of the pea aphid, the gene expression at 0h, 36h and 72h of Beauveria bassiana infection was analyzed, and the differentially expressed genes at different time points were compared and analyzed. A total of 567 differentially expressed genes were obtained by sequencing the transcriptome of the pea aphid infected with Beauveria bassiana Bb07, and NR annotation was performed on these differentially expressed genes. Most of these genes were down-regulated at 72h vs 36h. Therefore, seven target genes were screened out: Apgene4714, Apgene14740, Apgene14741, Apgene16968, Apgene15105, Apgene20844 and Apgene15782. Among them, Apgene4714 was an unidentified gene, which was significantly up-regulated at 36h and 72h; Apgene14740 and Apgene14741 were cathepsin genes, and KEGG analysis showed that they were involved in the lysosomal pathway; , the insect epidermis is the first barrier; Apgene15105 belongs to the cytochrome P450 family gene,...
Embodiment 2
[0031] Example 2 Gene interference of pea aphids combined with Beauveria bassiana to control aphids
[0032] 1. Synthesis of dsRNA from pea aphid
[0033] Follow the steps below:
[0034] 1) According to the transcriptome data, use the aphid online database (https: / / bipaa.genouest.org / is / aphidbase / ) to obtain the cDNA sequences of the pea aphid (scientific name: Acyrthosiphon pisum) Apgene4714, Apgene20844 and Apgene15782 genes, and design T7 promoter Apgene4714, Apgene20844, Apgene15782 gene-specific primers, the sequences of the upstream and downstream primers are respectively:
[0035] T7-Apgene4714-S1 (SEQ ID NO: 1):
[0036] TAATACGACTCACTATAGGGAAGACACCTAGTGGCTTGT;
[0037] T7-Apgene4714-A1 (SEQ ID NO: 2):
[0038] TAATACGACTCACTATAGGGTTGCAGCAGTGTTCAGATT;
[0039] T7-Apgene20844-S1 (SEQ ID NO: 3):
[0040] TAATACGACTCACTATAGGGGGCATTTAGCAAATCATAC;
[0041] T7-Apgene20844-A1 (SEQ ID NO: 4):
[0042] TAATACGACTCACTATAGGGCTGGTCGAGAATACACTTT;
[0043] T7-Apgene15782-S...
Embodiment 3
[0096] Example 3 Other Gene Interference Tests of Pea Aphid
[0097] According to the method of Example 2, experiments were also carried out on the pea aphid Apgene14740, Apgene14741, Apgene16968 and Apgene15105 genes, the corresponding dsRNA was synthesized, and the experimental combination was set up:
[0098] Apds14740 group: 1ml 0.05% Tween 80+1ml Apds14740 (2004ng / μl);
[0099] Apds14740+Bb07: 1ml Apds14740 (2004ng / μl)+1ml spore suspension (2×10 9 spores / mlBb07);
[0100] Apds14741 group: 1ml 0.05% Tween 80+1ml Apds14741 (2004ng / μl);
[0101] Apds14741+Bb07: 1ml Apds14741 (2004ng / μl)+1ml spore suspension (2×10 9 spores / mlBb07);
[0102] Apds15105 group: 1ml 0.05% Tween 80+1ml Apds15105 (2004ng / μl);
[0103] Apds15105+Bb07: 1ml Apds15105 (2004ng / μl)+1ml spore suspension (2×10 9 spores / mlBb07);
[0104] Apds16968 group: 1ml 0.05% Tween 80+1ml Apds16968 (2004ng / μl);
[0105] Apds16968+Bb07: 1ml Apds16968 (2004ng / μl)+1ml spore suspension (2×10 9 spores / mlBb07).
[0...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com