Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

OX40 monoclonal antibody and application thereof

A monoclonal antibody and expression vector technology, applied in applications, antibodies, antibody medical components, etc., can solve the problems of low affinity and low specificity of mouse monoclonal antibodies.

Inactive Publication Date: 2020-07-21
SHENZHEN INST OF ADVANCED TECH
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the specificity and affinity of these mouse monoclonal antibodies against OX40 on sale are not strong enough

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • OX40 monoclonal antibody and application thereof
  • OX40 monoclonal antibody and application thereof
  • OX40 monoclonal antibody and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1O

[0047] The production of embodiment 1OX40 monoclonal antibody

[0048]1.1. Construction and identification of pET32a(+)-OX40 recombinant plasmid

[0049] Using human full-length OX40cDNA as a template, upstream primer F: CATG CCATGG AACTCCACTGTGTCGGGGACACC, downstream primer R: CCC AAGCTT TTAGATGGCGGCAACCGCACG (the underlines are Noc I and Hind III restriction sites, respectively), to amplify the OX40 gene. PCR amplification program: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 50 s, annealing at 52°C for 35 s, extension at 72°C for 50 s, 29 cycles; extension at 72°C for 5 min. After electrophoresis and gel recovery, the PCR product was connected to the prokaryotic expression vector pET32a(+) and transformed into Escherichia coli BL21(DE3). Positive clones identified by Noc I and Hind III digestion were sent to Invitrogen for sequencing.

[0050] 1.2. Prokaryotic expression, identification and purification of OX40 protein

[0051] Inoculate the strains wi...

Embodiment 2O

[0058] Specificity and affinity of embodiment 2OX40 monoclonal antibody

[0059] 2.1. Detection of monoclonal antibody recognition of OX40 on the membrane surface by immunofluorescence

[0060] The cultured 293T cells were treated with 1×10 5 Cells / ml were seeded into 24-well plates with pretreated coverslips, and pLVX-IRES-ZsGreen and pLVXIRES-OX40-ZsGreen were transfected into 293T cells using liposomes, and placed in a CO2 incubator. Cultivate for 48h. Wash 3 times with ice-cold PBS, 5min each time. Fix with 3.7% paraformaldehyde at room temperature for 30 min, wash with PBS 3 times, 5 min each time. After sealed with 1% BSA at room temperature for 30 min, anti-OX40 monoclonal antibody diluted in 1% BSA was added, incubated at room temperature for 1 h, washed 3 times with PBS, 5 min each time. Add 1:400 diluted Dylight594-labeled goat anti-mouse secondary antibody and incubate at room temperature for 30 minutes, wash with PBS 3 times, 5 minutes each time. The slides we...

Embodiment 3

[0065] Example 3 Antibody Gene Variable Region Sequencing of OX40 Monoclonal Antibody Hybridoma Cells

[0066] Harvest monoclonal antibody 8F8 hybridoma cells in logarithmic growth phase, lyse with TRIZOL for RNA extraction, obtain cDNA after reverse transcription, amplify and obtain heavy and light chain variable regions, remove non-functional VK genes, and clone into The pMD18-T vector was sequenced, and the sequence results were compared using the IMGT / V-QUEST database for further analysis.

[0067] The base sequence of the heavy chain is shown in SEQ ID NO.1:

[0068] The amino acid sequence of the heavy chain variable region is shown in SEQ ID NO.2:

[0069] The base sequence of the light chain is shown in SEQ ID NO.3:

[0070] The amino acid sequence of the light chain variable region is shown in SEQ ID NO.4:

[0071] After comparison with the IMGT / V-QUEST database, the heavy chain:

[0072] CDR1-IMGT (SEQ ID NO.5):

[0073] CDR2-IMGT (SEQ ID NO. 6):

[0074] CDR3-...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of monoclonal antibody, in particular to an OX40 monoclonal antibody and application. The OX40 monoclonal antibody provided by the invention comprises (I), amino acid sequences of three CDR regions of a heavy chain; and (II) the amino acid sequences of the three CDR regions of its light chain; or an amino acid sequence obtained by substituting, deleting or addingone or more amino acids to the amino acid sequence and amino acid sequence having the same or similar function as the amino acid sequence; or an amino acid sequence having at least 80% homology to the sequence. Compared with the existing OX40 monoclonal antibody, the monoclonal antibody disclosed by the invention has stronger specificity and higher affinity to an antigen. The monoclonal antibodycan be used for detection of immunofluorescence staining, Western blot, ELISA, flow cytometry and the like.

Description

technical field [0001] The invention relates to the field of monoclonal antibodies, in particular to the OX40 monoclonal antibody and its application. Background technique [0002] OX40 (also known as CD134) belongs to the tumor necrosis factor receptor superfamily (TNFRSF), and is a type I transmembrane glycoprotein with a relative molecular mass of about 50kD. OX40 is a relatively conserved molecule, mainly expressed on the surface of activated CD4+ and CD8+ T cells, and its ligand OX40L is expressed on activated B cells, dendritic cells and endothelial cells. In the process of the body's immune response, OX40 / OX40L, as a pair of important co-stimulatory molecules, provides an important co-stimulatory signal for the activation of T and B cells, and its signal transduction is also related to the existence and function of effector cells. Because OX40 / OX40L plays an important role in the body's immune response and the occurrence and development of autoimmune diseases, and wi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K16/28C12N15/13A61K39/395A61P37/02G01N33/68
CPCA61K39/00A61P37/02C07K16/2878C07K2317/56C07K2317/565C07K2317/92G01N33/6872
Inventor 万晓春陈有海李俊鑫刘绿艳刘茂玄
Owner SHENZHEN INST OF ADVANCED TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com