Sequencing library construction method and kit for pathogenic microorganism detection
A technology of pathogenic microorganisms and sequencing libraries, which is applied in the field of sequencing library construction methods and kits for pathogenic microorganism detection, can solve the problems of low microbial content, error-prone, and difficult to meet the detection initial quantity requirements, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0078] Embodiment 1: the acquisition of mutant Tn5 transposase
[0079] The preparation method of the mutant Tn5 transposase whose amino acid sequence is shown in SEQ ID NO.1 comprises the following steps: Utilize the method of gene synthesis to synthesize the primer sequence comprising the site to be mutated and the substituted base as follows:
[0080] D24-f: CGGCGCTGGGTGAGCCTCGCCGTA
[0081] D24-r: TACGGCGAGGCTCACCCCAGCGCCG
[0082] A97-f: GCCATTGAGGAAACCACCT;
[0083] A97-r: AGGTGGTTTCCTCAATGGC;
[0084] K160-f: TGCGGATGAAAGGGAGAGTGGCAA
[0085] K160-r: TTGCCACTCTCCCTTTCATCCGC
[0086] C326-f: CGGATCGACGAGTTCCATA;
[0087] C326-r: TATGGAACTCGTCGATCCG;
[0088] Phanta Max Super-Fidelity DNA Polymerase (produced by Nanjing Nuoweizan Biotechnology Co., Ltd., Vazyme, product number P505) was used as the DNA polymerase. The amplification conditions were 95°C for 30s; 95°C for 15s; 60°C for 15s; 72°C for 30s-3min; 72°C for 5min; a total of 30 cycles. After amplification,...
Embodiment 2
[0090] Embodiment 2: Detect the stability of sample preservation solution
[0091] The sample preservation solution in the present invention includes: Tris-HCl 100mM, pH=8.0, guanidine hydrochloride 3M, cobalt chloride 2mM, EDTA.2Na 0.2M, Triton X-100 1%, sodium deoxycholate 1mM.
[0092] Pharyngeal swab specimens of normal people were put into the sample preservation solution of the present invention and the sample preservation solution sold in the market, one group was stored at 4°C for 24 hours, and the other group was stored at 56°C for 1 hour, and then RNA was extracted by conventional experimental methods. get as image 3 and Figure 4 the results shown, image 3 It is stored at 4°C for 24 hours, the first 3 holes are placed in the sample preservation solution of the present invention, and the last 3 holes are placed in the sample preservation solution sold in the market; Figure 4 It was stored at 56°C for 1 hour, the first 2 wells were placed in the sample preserva...
Embodiment 3
[0094] Example 3: DNA / RNA rapid common library construction based on mutant Tn5 transposase
[0095]The core of this example lies in the rapid joint library construction of DNA / RNA. The reverse transcriptase used in this example is HiScript III Reverse Transcriptase (Product No. R302) from Nanjing Novizan Biotechnology Co., Ltd.; the reverse transcription reaction buffer used is The buffer solution attached to HiScript III ReverseTranscriptase of Nanjing Novizan Biotechnology Co., Ltd.; the reverse transcription primer used is Oligo(dT) 20 Mixture of VN and random primers; Tn5 transposase is the mutant of D24E, D97E, K160R and E326D simultaneous mutation, namely: TTE-plus. The breaking buffer is the TTBL component in the TruePrep DNA library Prep Kit V2 for Illumina kit of Nanjing Nuoweizan Biotechnology Co., Ltd., that is, TruePrep Tagment Buffer L; breaking stop buffer 5×TS-plus, containing: 2.5% BSA, 1% Tween-20, 0.5% SDS, 25mM DTT; RNA purification magnetic beads are VAHT...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com