Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Bifidobacterium lactis BL-99 capable of regulating gastrointestinal florae and application of Bifidobacterium lactis BL-99

A technology of bifidobacterium lactis and live bacteria, applied in the field of microorganisms, can solve problems such as human health risks, achieve the effect of no antibiotic tolerance, wide application prospects, and growth promotion

Active Publication Date: 2020-04-07
INNER MONGOLIA YILI INDUSTRIAL GROUP CO LTD
View PDF2 Cites 14 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In addition, even though lactic acid bacteria are recognized as safe strains, studies in recent years have shown that many lactic acid bacteria, especially food-borne lactic acid bacteria and intestinal lactic acid bacteria, have also developed virulence factors and antibiotic resistance, posing potential risks to human health

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Bifidobacterium lactis BL-99 capable of regulating gastrointestinal florae and application of Bifidobacterium lactis BL-99
  • Bifidobacterium lactis BL-99 capable of regulating gastrointestinal florae and application of Bifidobacterium lactis BL-99
  • Bifidobacterium lactis BL-99 capable of regulating gastrointestinal florae and application of Bifidobacterium lactis BL-99

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Embodiment 1: Bifidobacterium lactis BL-99 and performance measurement thereof

[0036] The Bifidobacterium lactis BL-99 of the present invention is from Shanghai Jiaoda Only Co., Ltd., and is isolated from the intestinal tract of infants. The strain was preserved in China General Microorganism Culture Collection and Management Center CGMCC on April 26, 2018 (Address: No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences), taxonomic name: Bifidus lactis Bacillus (Bifidobacterium lactis); the deposit number is CGMCC No.15650.

[0037] 1. Taxonomic characteristics of Bifidobacterium lactis BL-99

[0038] Physical and chemical test results:

[0039]

[0040] 16S rRNA gene sequence sequencing results (SEQ ID No.1):

[0041] GCTCCCCCACAAGGGTCGGGCCACCGGCTTCGGGTGCTACCCACTTTCATGACTTGACGGGCGGTGTGTACAAGGCCCGGGAACGCATTCACCGCGGCGTTGCTGATCCGCGATTACTAGCGACTCCGCCTTCACGCAGTCGAGTTGCAGACTGCGATCCGAACTGAGACCGGTTTTCAGC...

Embodiment 2

[0055] Example 2: Analysis of the regulation effect of active Bifidobacterium lactis intestinal flora

[0056] This example intends to prove the effect of the Bifidobacterium lactis of the present invention on intestinal regulation. For the principle and steps, please refer to "Technical Specifications for Inspection and Evaluation of Health Food - Judgment Criteria for Regulating the Function of Intestinal Flora".

[0057] After culturing Bifidobacterium lactis BL-99 strain in MRS liquid medium at 37°C for 16 hours, centrifuge at 4°C and 2500rpm for 10 minutes to collect the bacteria, wash with phosphate buffer saline (PBS) and freeze-dry to obtain the bacterial powder Store below -18°C. Used in various experimental studies of this embodiment.

[0058] Take 36 healthy SPF grade BABL / c mice weighing 18-22 g (provided by Beijing Huafukang Biotechnology Co., Ltd.). After 3 days of adaptive feeding, they were randomly divided into 3 groups, 12 in each group, namely blank contro...

Embodiment 3

[0079] Example 3: Comparison of intestinal flora regulation effects of different doses of active Bifidobacterium lactis and inactivated strains

[0080] In this example, the intestinal flora regulation effects of different doses of active Bifidobacterium lactis BL-99 and inactivated strains were tested.

[0081] Viable bacteria sample: According to the sample specification, weigh 1g of viable bacterial sample and suspend it to 40ml with PBS solution, that is, the concentration of viable bacteria is 2.5x10 9 CFU / ml.

[0082] High-dose group: calculated according to the amount of 0.2ml / 10g intragastric administration of mice, the intragastric administration amount of 20g mice is 0.4ml, and the intragastric administration dose of mice in high-dose group is 10 9 CFU / 20g.

[0083] Medium-dose group: Take 5ml of high-dose suspension and add PBS to make up to 50ml respectively. According to the calculation of 0.2ml / 10g gavage volume of mice, the gavage volume of 20g mice is 0.4ml, ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention provides a Bifidobacterium lactis capable of regulating gastrointestinal florae and application of the Bifidobacterium lactis BL-99, and belongs to the technical field of microorganisms. The Bifidobacterium lactis has gastric acid resistance, the survival rate of viable bacteria is 62% or above after the Bifidobacterium lactis BL-99 is treated for 30 min in a pH 2.5 gastric acid solution, and the survival rate of viable bacteria is 61% or above after the Bifidobacterium lactis BL-99 is treated for 2 h. The bacterium can significantly promote the growth of bifidobacteria and lactic acid bacteria, and can inhibit desulphovibrio / enterobacter in intestinal tracts, especially curatively inhibit helicobacter pylori and / or Escherichia-Shigella, can be used to prepare food, medicines and feed with gastrointestinal tract flora regulation effects, and has wide application prospects.

Description

technical field [0001] The invention relates to the technical field of microbes, in particular to a bifidobacterium lactis which has gastric acid resistance and intestinal juice resistance and can significantly promote the growth of bifidobacteria and lactic acid bacteria and its application. Background technique [0002] The balance of intestinal flora is closely related to human health. The intestinal flora includes beneficial bacteria, neutral bacteria and harmful bacteria. Beneficial bacteria occupy a dominant position in a healthy human intestinal tract and constantly interact with harmful bacteria to maintain human health. If the beneficial bacteria in the intestinal tract are reduced due to various factors, the harmful bacteria will multiply and the micro-ecological balance in the intestine will be broken, causing various clinical symptoms such as enteritis and diarrhea. At the same time, a large number of antibiotics are usually used clinically. Although they can ef...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/20A23L33/135A23C9/123A23C19/032A23C19/06A23K10/18A61K35/745A61P1/00C12R1/01
CPCC12N1/20A23L33/135A23C9/1234A23C19/0323A23C19/062A23K10/18A61P1/00A23V2002/00A61K2035/115C12R2001/01C12N1/205A23V2400/531A23V2200/3204Y02A50/30
Inventor 洪维鍊刘伟贤赵雯孙婷司徒文佑
Owner INNER MONGOLIA YILI INDUSTRIAL GROUP CO LTD
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More