Fusarium oxysporum tor gene RNAi carrier and method for combined control of potato dry rot and wilt with salicylic acid
A technology of Fusarium oxysporum and potato drying, applied in the fields of molecular biology and plant disease control, to achieve the effects of weakening pathogenicity, reducing plant wilt and dry rot, and reducing the use
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0021] Embodiment 1, plant hormone salicylic acid (SA) inhibits the hyphal growth and pathogenicity of Fusarium oxysporum 1. Process Fusarium oxysporum on a plate with different concentrations of SA
[0022] Prepare PDA plates with different concentrations of SA of 0.5mmol / L, 1mmol / L, 5mmol / L, 10mmol / L, and 15mmol / L under sterile conditions. PDA medium was placed in the middle of the plate. After sealing, they were cultured in a fungal incubator at 25°C, and each treatment was replicated at least three times. After cultivating Fusarium oxysporum for 5 days, observe and count the diameter of fungal hyphae; at the same time, observe the mycelial morphology of Fusarium oxysporum after cultivating for 5 days under a scanning electron microscope, and the results are as follows: figure 1 Shown in B. According to the experimental results, it was found that with the increase of SA concentration, the mycelial growth was more and more inhibited, indicating that SA inhibited the growth...
Embodiment 2
[0025] Example 2. Study on the pathogenicity of Fusarium oxysporum to potato after silencing the FoTOR gene of Fusarium oxysporum by siRNAs
[0026] 1. Design and synthesis of siRNAs against FoTOR
[0027] Using the yeast TOR protein as a reference to search the genome database of Fusarium oxysporum, it was found that Fusarium oxysporum contains two TOR genes, and their full-length CDS sequences are FoTOR1:7329bp; FoTOR2:5277bp. For the CDS sequence of FoTOR, the following siRNAs were designed and synthesized using siRNA design software. siRNA1: CCTTACAAACACCAGGTAATT (Seq ID No: 6); siRNA2: GCAAGATCCTGCTCAACATTT (Seq ID No: 7); siRNA3: GAGGTGGCGATGAAGAGAGTT (Seq ID No: 8); Negative control (Negative control, NC): TTCTCCGAACGTGTCACGTTT (Seq ID No: 9). siRNAs were synthesized at Sangon Bioengineering (Shanghai) Co., Ltd.
[0028] 2. siRNAs inoculation experiment
[0029] The synthetic siRNAs were mixed with the spore suspension of Fusarium oxysporum to inoculate potato leaves a...
Embodiment 3
[0030] Embodiment 3, Fusarium oxysporum TOR gene RNAi expression vector construction
[0031] The CDS sequences of FoTOR1 and FoTOR2 of Fusarium oxysporum were homologously compared in NCBI to find out the most suitable sequence for constructing RNAi interference vector, and the RNAi interference sequences of FoTOR1 and FoTOR2 were combined and named FoTOR12. The sequence of FoTOR12 is Seq ID No: 1 (the one without underline is FoTOR1, and the one with underline is FoTOR2):
[0032] CGATCCAGGAGAGACTACTTGATATGCTCAGCGTAGTTCTCTGCGGTGAGCCATTTAAACCCCTTGGCGCTCCACAACCAAATACTCTCAGCTCAGTCCCGATTATTCCCAAAGACGCAAAAGACCCCCACGCTTATGAGCACCGAAGGGCTGAGGTCAAGTTGGCGCTCAACACTCTCGGTAGTTTCGATTTCTCAGGACATGTTCTGAACGAGTTTGTTCGAGACGTCGCAATCAAGTACGTTGAAGACGAGGATCCAGAAATCCGTGAGGCAGCGGCCTTGACATGCTGCCAATTAT CACCACGCGGCTGTGATTGAAGCTATTATGAACATCTTCCGCACCCTGGGCTTGGAGTGTGTTTCGTTCCTT GATAGAATCATACCGGCATTCCTCCAGGTGATACGATCGGCCACTTCCACGAGACCCGAGTCTTACTTCAACCAAC TGGCCACTCTCGTCAGCATCGTGCGGCAACATATAAGAAATTATCTT...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com