Rapid detection method of treponema pallidum antibody in serum and application thereof
A technology of treponema pallidum and a detection method, which is applied in the direction of measuring devices, analysis through chemical reactions of materials, instruments, etc., can solve the problems of false positive detection methods and achieve the effect of sensitive and rapid detection
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] The construction and expression of TP15 / TP17 / TP47-Luc146 fusion protein gene clone, its steps are:
[0040] 1) Genes for the synthesis of Luc146, TP15, TP17, and TP47:
[0041] Genes of Luc146, TP15, TP17, and TP47 were synthesized in a bioengineering company. The gene sequence of luciferase Luc146 is:
[0042]ATGGCCGATAAAAACATTCTGTATGGTCCGGAACCGTTTTATCCGCTGGAAGATGGTACAGCCGGTGAGCAGATGTTTGATGCACTGAGCCGTTATGCAGCAATTCCGGGTTGTATTGCACTGACCAATGCACATACCAAAGAAAACGTGCTGTATGAAGAGTTTCTGAAACTGAGCTGTCGTCTGGCAGAATCCTTTAAAAAGTATGGCCTGAAACAGAACGATACCATTGCAGTTTGTAGCGAAAATTCCCTGCAGTTTTTTCTGCCGGTTATTGCAAGCCTGTATCTGGGTATTATTGTTGCACCGGTGAACGACAAATATATCGAACGTGAACTGATTCATAGCCTGGGTATTGTTAAACCGCGTATTGTTTTCTGTAGCAAGAACACCTTTCAGAAAGTGCTGAACGTTAAGAGCAAACTGAAAAGCATTGAAACCATCATCATCCTGGATCTGAATGGATTTCAGTCGATGTACACGTTCGTCACATCTCATCTACCTCCCGGTTTTAATGAATACGATTTTGTGCCAGAGTCCTTCGATAGGGACAAGACAATTGCACTGATCATGAACTCCTCTGGATCTACTGGTCTGCCTAAAGGTGTCGCTCTGCCTCATAGAACTGCCTGCGTGAGATTCTCGCATGCCAGAGATCCTATTTTTGGCAATC...
Embodiment 2
[0078] Thermostability assay of luciferase Luc146.
[0079]In order to detect the thermostability of luciferase Luc146, and compare with the thermostability of wild-type firefly luciferase, use the plasmid Escherichia coli strain with the firefly luciferase gene purchased from Promega Company, according to step 6 in Example 1 ) and 7) to induce the expression and purification of the wild-type luciferase Luc, and use the company's synthetic Luc146 gene on the pET28a carrier Escherichia coli BL21 (DE3) to induce the expression and purification of luciferase Luc146, through the BCA method ( BCA Protein Assay Kit was purchased from Thermo Scientific Company) to measure the concentration of Luc and Luc146, and the two luciferases were treated with pH 7.4, 50mM Tris-HCl, 10mM MgCl 2 The buffer solution was adjusted to a concentration of 1 mg / mL, and the temperature of the water bath was adjusted to 60°C in advance, and 10 μL samples were taken at 0 min, 10 min, 30 min, and 60 min t...
Embodiment 3
[0081] The establishment of the rapid detection method of Treponema pallidum antibody in serum, its steps are:
[0082] (1) Vortex and mix the protein A / G-resin particles, take 100 μL into a 1.5mL EP tube, add 200 μL buffer I, centrifuge at 2500 g for 1 min after mixing, discard the supernatant, repeat washing three times, and finally suspend the particles In 200 μL buffer I.
[0083] (2) Take 10 μL of resin particles from step (1) in a 200 μL PCR tube, add 1 μL of serum samples and corresponding negative and positive controls, 9 μL of buffer I, then add 10 μL of 250 μg / mL TP15 / TP17 / TP47-Luc146, mix After homogeneity, place in an incubator at 28°C and incubate at 300rpm for 15min.
[0084] (3) Add 200 μL PBST to wash the resin in step (2), discard the supernatant, repeat three times, and add 100 μL buffer II.
[0085] (4) Add 10 μL of 5 mM D-luciferin, 10 μL of 1 μM ATP, and 80 μL of buffer II to the special reaction tube of the hand-held luminescence detector.
[0086] (5)...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com