Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Rapid detection method of treponema pallidum antibody in serum and application thereof

A technology of treponema pallidum and a detection method, which is applied in the direction of measuring devices, analysis through chemical reactions of materials, instruments, etc., can solve the problems of false positive detection methods and achieve the effect of sensitive and rapid detection

Inactive Publication Date: 2019-11-15
WUHAN INST OF VIROLOGY CHINESE ACADEMY OF SCI
View PDF4 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Serological tests are now the main method for diagnosing syphilis, commonly used are TPA (Treponemal pallidum gelatin particle agglutination test), FTA-ABS (fluorescent treponemal antibody adsorption test), ELISA (enzyme-linked immunosorbent assay) and TRUST (toluidine red not Heated serum test), etc., due to the existence of false positives in various detection methods, the improvement of detection speed and the limitation of relying on laboratory instruments such as microscopes, etc., it is necessary to develop a rapid on-site syphilis antibody detection method

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Rapid detection method of treponema pallidum antibody in serum and application thereof
  • Rapid detection method of treponema pallidum antibody in serum and application thereof
  • Rapid detection method of treponema pallidum antibody in serum and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] The construction and expression of TP15 / TP17 / TP47-Luc146 fusion protein gene clone, its steps are:

[0040] 1) Genes for the synthesis of Luc146, TP15, TP17, and TP47:

[0041] Genes of Luc146, TP15, TP17, and TP47 were synthesized in a bioengineering company. The gene sequence of luciferase Luc146 is:

[0042]ATGGCCGATAAAAACATTCTGTATGGTCCGGAACCGTTTTATCCGCTGGAAGATGGTACAGCCGGTGAGCAGATGTTTGATGCACTGAGCCGTTATGCAGCAATTCCGGGTTGTATTGCACTGACCAATGCACATACCAAAGAAAACGTGCTGTATGAAGAGTTTCTGAAACTGAGCTGTCGTCTGGCAGAATCCTTTAAAAAGTATGGCCTGAAACAGAACGATACCATTGCAGTTTGTAGCGAAAATTCCCTGCAGTTTTTTCTGCCGGTTATTGCAAGCCTGTATCTGGGTATTATTGTTGCACCGGTGAACGACAAATATATCGAACGTGAACTGATTCATAGCCTGGGTATTGTTAAACCGCGTATTGTTTTCTGTAGCAAGAACACCTTTCAGAAAGTGCTGAACGTTAAGAGCAAACTGAAAAGCATTGAAACCATCATCATCCTGGATCTGAATGGATTTCAGTCGATGTACACGTTCGTCACATCTCATCTACCTCCCGGTTTTAATGAATACGATTTTGTGCCAGAGTCCTTCGATAGGGACAAGACAATTGCACTGATCATGAACTCCTCTGGATCTACTGGTCTGCCTAAAGGTGTCGCTCTGCCTCATAGAACTGCCTGCGTGAGATTCTCGCATGCCAGAGATCCTATTTTTGGCAATC...

Embodiment 2

[0078] Thermostability assay of luciferase Luc146.

[0079]In order to detect the thermostability of luciferase Luc146, and compare with the thermostability of wild-type firefly luciferase, use the plasmid Escherichia coli strain with the firefly luciferase gene purchased from Promega Company, according to step 6 in Example 1 ) and 7) to induce the expression and purification of the wild-type luciferase Luc, and use the company's synthetic Luc146 gene on the pET28a carrier Escherichia coli BL21 (DE3) to induce the expression and purification of luciferase Luc146, through the BCA method ( BCA Protein Assay Kit was purchased from Thermo Scientific Company) to measure the concentration of Luc and Luc146, and the two luciferases were treated with pH 7.4, 50mM Tris-HCl, 10mM MgCl 2 The buffer solution was adjusted to a concentration of 1 mg / mL, and the temperature of the water bath was adjusted to 60°C in advance, and 10 μL samples were taken at 0 min, 10 min, 30 min, and 60 min t...

Embodiment 3

[0081] The establishment of the rapid detection method of Treponema pallidum antibody in serum, its steps are:

[0082] (1) Vortex and mix the protein A / G-resin particles, take 100 μL into a 1.5mL EP tube, add 200 μL buffer I, centrifuge at 2500 g for 1 min after mixing, discard the supernatant, repeat washing three times, and finally suspend the particles In 200 μL buffer I.

[0083] (2) Take 10 μL of resin particles from step (1) in a 200 μL PCR tube, add 1 μL of serum samples and corresponding negative and positive controls, 9 μL of buffer I, then add 10 μL of 250 μg / mL TP15 / TP17 / TP47-Luc146, mix After homogeneity, place in an incubator at 28°C and incubate at 300rpm for 15min.

[0084] (3) Add 200 μL PBST to wash the resin in step (2), discard the supernatant, repeat three times, and add 100 μL buffer II.

[0085] (4) Add 10 μL of 5 mM D-luciferin, 10 μL of 1 μM ATP, and 80 μL of buffer II to the special reaction tube of the hand-held luminescence detector.

[0086] (5)...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a rapid detection method of the treponema pallidum antibody in serum and an application thereof. According to the rapid detection method of the treponema pallidum antibody in serum, resin particles modified with protein A and protein G are used for capturing the antibody in serum; the luciferase-fused syphilis lipoproteins TP15, TP17 and TP47 are used for combination with the antibody captured on the resin; and then sensitive and rapid detection of the treponema pallidum antibody in serum is realized by detecting the luminescent activity of the fused thermostable luciferase. The luciferase and syphilis lipoprotein fusion protein used by the rapid detection method of the treponema pallidum antibody in serum can specifically bind to the antibody of treponema pallidum,and the luciferase therein is a luciferase with good thermal stability. The fusion protein is applied to the rapid detection method disclosed by the invention, the rapid detection method uses a smallamount of serum sample, and only 1 [Mu]L of serum can be used to detect the treponema pallidum antibody in serum within 20 minutes, which can accurately distinguish negative or positive of the antibody and has similar sensitivity to the traditional ELISA.

Description

technical field [0001] The invention relates to the technical field of detection of pathogenic antibodies, in particular to a rapid detection method for Treponema pallidum antibodies in serum and an application thereof. Background technique [0002] Syphilis is a chronic, systemic infectious disease whose pathogen is Treponema pallidum, which is transmitted through sexual contact, blood transfusion or mother-to-child transmission. According to the statistics of the World Health Organization, there are as many as 12 million new cases of syphilis infection each year worldwide. New cases of infant-to-infant transmission are increasing, and syphilis infection makes HIV more susceptible to infection and transmission. [0003] Serological tests are now the main method for diagnosing syphilis, commonly used are TPA (Treponemal pallidum gelatin particle agglutination test), FTA-ABS (fluorescent treponemal antibody adsorption test), ELISA (enzyme-linked immunosorbent assay) and TRUST...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): G01N33/571G01N21/64G01N21/76
CPCG01N21/6428G01N21/763G01N33/571G01N2021/6439
Inventor 危宏平余军平李俊花
Owner WUHAN INST OF VIROLOGY CHINESE ACADEMY OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com