Recombinant plasmid used for synthesizing glutathione and preparation method thereof
A recombinant plasmid and glutathione technology, applied in the field of bioengineering, can solve problems such as unfavorable sustainable development, complicated operation steps, environmental damage, etc., and achieve the effects of improving efficiency, reducing degradation, reducing production costs and energy consumption
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0040] Example 1: Construction of pET-22b-GshF expression plasmid
[0041] 1.1 Primer design
[0042] According to the GshF sequence reported by NCBI, the following two primers were designed to amplify the GshF gene:
[0043] GshF-F: CAGCCGGCGATGGCCATGGATATGATAAAACTTGATATGA (SEQ ID NO. 3)
[0044] GshF-R: TGGTGGTGGTGGTGCTCGAGGTCAAATAAGAAATCTAAAAT (SEQ ID NO. 4)
[0045] Among them, GshF-F and GshF-R are used to amplify the GshF coding region; an NcoI restriction site is introduced into GshF-F, and an XhoI restriction site is introduced into GshF-R. The part of GshF-F and GshF-R homologous to pET-22b was used to clone the GshF gene into the pET-22b vector, and the kit used was ClonExpress II.
[0046] 1.2 PCR amplification of GshF sequence
[0047] The pMD19-T-GshF vector was obtained by extraction with the Sangon plasmid extraction kit.
[0048] Using the genome of Listeria monocytogenes as a template, use the GshF-F and GshF-R upstream and downstream primers designed in ...
Embodiment 2
[0057] Embodiment 2: optimization of fermentation conditions
[0058] Orthogonal test L9(3 4 ) optimize the temperature (°C), IPTG concentration (mM), fermentation pH, and reaction time (h), see Table 1 for detailed design,
[0059] Take the recombinant strain prepared in Example 1 at -80°C, add it into 10mL LB medium according to 1% volume ratio, cultivate overnight at 37°C, 180rpm, and inoculate it into 15mL LB medium according to 1% volume ratio the next day, according to Different conditions were optimized, and the final concentration of glutamic acid, cysteine, and glycine was 4mM. After the cultivation, 1mL of the bacterial liquid was taken and extracted with 40% ethanol at a ratio of 1:1, then vortexed, 12000rpm After centrifugation for 3 min, the supernatant was taken to determine the content of glutathione by the alloxan method.
[0060] Table 1
[0061] Level temperature °C IPTG concentration / mM pH Reaction time / h 1 16 0.1 3 6 2 25 ...
Embodiment 3
[0063] Embodiment 3 fermentation medium optimization
[0064] Orthogonal test L9(3 4 ) to optimize the carbon source, nitrogen source and ATP concentration, see Table 2 for detailed design.
[0065] Take the recombinant strain prepared in Example 1 at -80°C, add it into 10mL LB medium according to 1% volume ratio, cultivate overnight at 37°C, 180rpm, and inoculate 15mL of the following medium according to 1% volume ratio the next day, The final concentrations of glutamic acid, cysteine, and glycine were all 4mM, the concentration of IPTG was 0.5mM, the pH was adjusted to 5, and the reaction was carried out at 16°C for 12h. Extracted with 40% ethanol, then vortexed, centrifuged at 12000rpm for 3min, and the supernatant was taken for determination of glutathione content by the alloxan method.
[0066] Table 2
[0067]
[0068] Test results such as Figures 5 to 7 ,in, Figure 5 Adopt 10g / L beef extract as nitrogen source, under the condition that ATP concentration is 10m...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com