Drug for preventing and treating myocardial ischemia reperfusion injury or treating cardiac ischemic diseases

A technology for ischemic disease and reperfusion injury, applied in cardiovascular system diseases, gene therapy, drug combination, etc., can solve the problems of tFNAs research reports that have not been seen, and achieve the effect of reducing oxidative damage, increasing proliferation, and reducing release

Pending Publication Date: 2019-10-01
SICHUAN UNIV
View PDF4 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] At present, there are no reports on tFNAs in ischemic heart disease and myocardial ischemia-reperfusion injury

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Drug for preventing and treating myocardial ischemia reperfusion injury or treating cardiac ischemic diseases
  • Drug for preventing and treating myocardial ischemia reperfusion injury or treating cardiac ischemic diseases
  • Drug for preventing and treating myocardial ischemia reperfusion injury or treating cardiac ischemic diseases

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Synthesis and identification of embodiment 1 tFNA

[0035] 1. Synthesis method

[0036] Dissolve the four DNA single strands (S1, S2, S3, S4) in TM Buffer (10mM Tris-HCl, 50mM MgCl2, pH=8.0), the final concentration of the four DNA single strands is 1000nM, mix well, heat rapidly to 95°C and keep After 10 minutes, the temperature was quickly lowered to 4°C and maintained for more than 20 minutes to obtain tetrahedral skeleton nucleic acid.

[0037] The sequences of the four single strands (5'→3') are as follows:

[0038] S1: ATTTATCACCCGCCATAGTAGACGTATCACCAGGCAGTTGA

[0039] GACGAACATTCCTAAGTCTGAA (SEQ ID NO. 1)

[0040] S2: ACATGCGAGGGTCCAATACCGACGATTACAGCTGCTACAC

[0041] GATTCAGACTTAGGAATGTTCG (SEQ ID NO. 2)

[0042] S3: ACTACTATGGCGGGTGATAAAACGTGTAGCAAGCTGTAATC

[0043] GACGGGAAGAGCATGCCCATCC (SEQ ID NO. 3)

[0044] S4: ACGGTATTGGACCCTCGCATGACTCAACTGCCTGGTGATAC

[0045] GAGGATGGGCATGCTCTTCCCG (SEQ ID NO. 4)

[0046] 2. Identification

[0047] After the syn...

experiment example 1

[0049] Experimental example 1 In vitro model experiment of cardiomyocyte ischemia-reperfusion

[0050] 1. Method

[0051] 1.1 Ischemia-reperfusion treatment (SIR)

[0052] H9C2 cells in the logarithmic growth phase were collected and divided into control group, SIR group, and SIR+tFNAs group. After 24 hours of adherent growth, the three groups discarded the original culture medium (high glucose DMEM), washed with PBS for 3 times, and the control group was treated with The DMEM medium containing 1% FBS continued to be cultured in a normoxic incubator.

[0053] SIR, SIR+tFNAs groups were added artificial hypoxia solution (10mM deoxyglucose, 4mM 4-hydroxyethylpiperazineethanesulfonic acid, 137mM NaCl, 0.49mM MgCl2, 12mM KCl, 20mM lactate, 0.9mM CaCl 2 2H2 O, pH 6.5), placed in an incubator containing 94% nitrogen, 1% oxygen, and 5% carbon dioxide and cultured for 3 hours; the anoxic solution was sucked off, and the SIR group was added with DMEM medium containing 1% FBS, SIR+tFN...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides a drug for reducing myocardial damage caused by ischemia reperfusion or a drug for treating cardiac ischemic diseases. The drug is prepared by taking a DNA tetrahedron as an active ingredient and adding pharmaceutically acceptable auxiliary materials, wherein the DNA tetrahedron is a tetrahedral structure formed by hybridization of four DNA single strands according to the same amount of substance. The drug has good protection and repair functions on myocardium, inhibits apoptosis of myocardial cells, and has the good curative effect on myocardial infarction and other ischemic diseases.

Description

technical field [0001] The invention belongs to the field of heart disease drugs, in particular to a drug for preventing and treating myocardial ischemia-reperfusion injury or treating heart ischemic diseases. Background technique [0002] Ischemic heart disease is a heart disease caused by insufficient coronary blood supply, including myocardial infarction, angina pectoris, and chronic ischemic heart disease. Usually the treatment of these diseases relies on thrombolytic drugs or interventional therapy to restore blood supply. However, restoration of blood flow to myocardial tissue during treatment can cause new damage, a phenomenon known as myocardial ischemia-reperfusion injury. [0003] During the treatment of ischemic heart disease, it is necessary to prevent and treat myocardial ischemia-reperfusion injury. There are many related studies, involving a variety of drugs, including rehmannia polysaccharide, geniposide, matrine A, matrine, berberine, etc. , Volume 47, Is...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): A61K48/00A61P9/10
CPCA61K48/005A61P9/10
Inventor 林云锋张梅秦鑫朱君瑶蔡潇潇
Owner SICHUAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products