Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A kind of filamentous fungus Aspergillus niger strain for producing biological oil and its application

A technology of Aspergillus niger strain and microbial oil, which is applied in the field of bioengineering, can solve the problems of difficult promotion of biodiesel, high cost of raw materials, aggravated food crisis, etc., and achieves the effects of simple production process control, improved oil production efficiency, and easy acquisition.

Inactive Publication Date: 2021-02-02
THIRD INST OF OCEANOGRAPHY MINIST OF NATURAL RESOURCES +1
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, these oil raw materials are important food crops. If these crops are used as raw materials for biodiesel production in large quantities, it will not only aggravate the food crisis, but also make it difficult to promote the production of biodiesel due to the high cost of raw materials.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of filamentous fungus Aspergillus niger strain for producing biological oil and its application
  • A kind of filamentous fungus Aspergillus niger strain for producing biological oil and its application
  • A kind of filamentous fungus Aspergillus niger strain for producing biological oil and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0113]Example 1. Isolation and identification of Aspergillus niger E1 strain

[0114]The Aspergillus niger E1 strain of the present invention is isolated from the DY23I voyage overlying water at W154°20'N9°59' in the sea area of ​​the Central Pacific Ocean.

[0115]The genomic DNA of the strain isolated in seawater was extracted, and PCR amplification was performed using fungal universal primers ITS1 and ITS4, and the obtained PCR base sequence (SEQ ID NO.1) was subjected to BLAST comparison analysis in the NCBI database After identification, the strain was found to be a new Aspergillus niger strain, named Aspergillus niger strain E1. Its ITS sequence is shown in SEQ ID NO.1:

[0116]TGGAAGAATGGTTGGAAAACGTCGGCAGGCGCCGGCCAATCCTACAGAGCATGTGACAAAGCCCCATACGCTCGAG GATCGGACGCGGTGCCGCCGCTGCCTTTCGGGCCCGTCCCCCCGGAGAGGGGGACGGCGACCCAACACACAAGCCG GGCTTGAGGGCAGCAATGACGCTCGGACAGGCATGCCCCCCGGAATACCAGGGGGCGCAATGTGCGTTCAAAGACT CGATGATTCACTGAATTCTGCAATTCACATTAGTTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGA GATCC...

Embodiment 2

[0117]Example 2. Cultivation of Aspergillus niger E1 strain and detection of related indexes

[0118]1. Medium preparation

[0119]Preparation of potato dextrose agar medium (PDA): Take 200g potatoes (peeled), cut into small pieces, add about 1L of artificial sea water, boil for 30min, filter with 8 layers of gauze, take the filtrate, add 20g glucose and 15g agar, and dilute the volume with distilled water To 1L, autoclave at 121℃ for 20min.

[0120]The preparation of the seed medium (YEPD): 20g glucose, 10g peptone, 10g yeast powder, prepared with artificial seawater, adjust the pH to 6.0, and dilute to 1L, autoclave at 121°C for 20min.

[0121]Preparation of basic nitrogen-limited lipid-producing medium: 70g glucose, 1.8g peptone, 0.5g yeast powder, KH2PO4 2.0g, MnSO4·H2O 0.005g, CuSO4·5H2O 0.0003g, MgSO4·7H2O 0.8g, prepared with artificial sea water, adjust pH to 6.0, and dilute to 1L, autoclave at 121°C for 20 minutes.

[0122]Preparation of artificial sea water: NaCl 24.477g, Na2SO4 3.9170g, ...

Embodiment 3

[0136]Example 3. Optimization of fermentation conditions and culture medium of Aspergillus niger E1 strain

[0137]1. Optimization of training time

[0138]First, liquid seed culture is performed, and then shake flask fermentation culture is performed. Refer to Example 1 for the specific process. Here, the basic nitrogen-limited lipid-producing medium was used for fermentation culture, and the fermentation culture was continued at 28°C for 9 days and the rotation speed was 160 rpm. Biomass, oil content and oil production were tested for each bacterial liquid of 1, 2, 3, 4, 5, 6, 7, 8, and 9 days of fermentation, and the results are shown infigure 1 in.

[0139]Fromfigure 1 It can be seen that the biomass of the Aspergillus niger E1 strain reached the maximum value of 12.70 g / L when the fermentation and culture reached the 7th day, and the oil content did not reach the maximum value at this time. On the contrary, when the Aspergillus niger E1 strain was fermented to the 5th day, the oil conte...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of bioengineering, in particular to a filamentous fungus Aspergillus niger (Aspergillus niger) strain E1 for producing biological oil and its application. The invention optimizes the fermentation conditions and culture medium of the oil-producing strain Aspergillus niger strain E1, so that the culture biomass is as high as 10.49g / L, and the oil content is as high as 4.59g / L. The biomass and oil content increased by 14.39% and 85.08% respectively compared with before optimization. The Aspergillus niger strain E1 provided by the present invention can produce various fatty acids such as oleic acid, α-linolenic acid, and behenic acid. The strain can be widely used in the production of fatty acids and biodiesel, and has extensive industrial application value.

Description

Technical field[0001]The invention relates to the technical field of bioengineering. Specifically, the present invention relates to a filamentous fungus Aspergillus niger strain for producing bio-oil and its application.Background technique[0002]Biodiesel refers to vegetable oils (such as rapeseed oil, soybean oil, peanut oil, corn oil, cottonseed oil, etc.), animal oils (such as fish oil, lard, tallow, sheep oil, etc.), waste oils or microbial oils, methanol or ethanol, etc. Fatty acid methyl or ethyl esters formed by ester conversion. Biodiesel is a typical "green energy", with good environmental performance, good engine starting performance, good fuel performance, wide raw material sources, and renewable characteristics. Vigorously developing biodiesel has important strategic significance for sustainable economic development, promotion of energy substitution, reduction of environmental pressure, and control of urban air pollution.[0003]The current preparation method of biodiesel ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N1/14C12P7/64C12R1/685
CPCC12N1/14C12P7/6436C12P7/649C12N1/145C12R2001/685Y02E50/10
Inventor 骆祝华徐炜陈逍遥张家伟
Owner THIRD INST OF OCEANOGRAPHY MINIST OF NATURAL RESOURCES
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com