Novel crispr enzymes and systems
A technology of effector proteins and complexes, applied in hydrolases, retroRNA viruses, biochemical equipment and methods, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[2115] Example 1: Materials and methods of Cpf1 in vivo
[2116] DNA construct
[2117] Has been included by using forward PCR primers
[2118] HA-NLS(aacacaggaccggtgccaccatgtacccatacgatgttccagattacgcttcgccgaagaaaaagcgcaaggtcgaagcgtccacacagttcgagggctttaccaacctgtatcaggtgagc
[2119] (spA)(gcggccgcacacaaaaaaccaacacacagatctaatgaaaataaagatcttttattgaattcttagttgcgcagctcctggatgtaggccagcc)(ref) PCR amplify the sequence (ref) encoding AsCpf1, and clone the resulting PCR template into the (Synapsin) promoter using the human synaptic protein (Synapsin) And generate AAVhSyn-HA-NLS-AsCpf1-spA vector. In order to generate AAVpU6-sgRNA(SapI)-hSyn-GFP-KASH-hGH and pU6-3xgRNA-hSyn-GFP-KASH-hGH vectors, the gene blocks encoding pU6-DR(SapI) and pU6-3xgRNA have been cloned into AAVhSyn- In the GFP-KASH-hGH backbone (unpublished). All constructs have been verified by sequencing. In order to generate the AAVsMecp2-HA-NLS-AsCpf1-spA-tRNAp-3xgRNA vector, the gene block encoding the tRNA promoter (tRNAp)...
Embodiment 2
[2192] Example 2: AsCpf1 is effectively delivered to the brain and mediates editing
[2193] AsCpf1 effectively cuts primary neurons ( figure 1 ). AsCpf1 and guide RNA target the nucleus of neurons after infection. Seven days after infection, multiple cuts were observed in three separate cases. Stereotactic AAV1 / 2 injections for AsCpf1 delivery into the hippocampus of mice also showed virus delivery and GFP fluorescence after 3 weeks of virus delivery ( figure 2 A). Systemic delivery of AsCpf1 and GFP-KASH to adult mice using a two-vector method showed immunostaining 3 weeks after systemic tail vein injection, thus showing the delivery of Syn-GFP-KASH vector to neurons in various brain regions ( Figure 3A ). Next-generation sequencing indel analysis of each brain region dissected 3 weeks after the systemic tail vein co-injection of the dual vector showed indel analysis in each region of the brain at the three target loci. The AAV1 / 2 dual vector was stereotactically injected...
Embodiment 3
[2204] The impact of human genetic variation on CRISPR-based therapeutic genome editing
[2205] method
[2206] data set
[2207] Our target variation analysis was performed using the Exome Aggregation Consortium (ExAC) data set from 60,706 different individuals around the world1. Our research on off-target candidates was conducted using the Phase 3 dataset of the Thousand Genome Project, which contains phased whole genome sequences of 2,504 different individuals around the world2.
[2208] Target Variation Analysis of Whole Exome
[2209] We include all targets in the human exome for the CRISPR enzymes SpCas9-WT, SpCas9-VQR, SpCas9-VRER, SaCas9 and AsCpf1, which are mapped to the protein coding regions of the exons, and the average coverage of each ExAC sample The degree is at least 20 readings. In order to analyze the variation of these targets, as mentioned earlier, we included all missense or synonymous variants 1 that passed the quality filtering in the ExAC data set. Because ...
PUM
Property | Measurement | Unit |
---|---|---|
size | aaaaa | aaaaa |
molecular weight | aaaaa | aaaaa |
wavelength | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com